Rh2BG200200

MRG

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
18372720 .. 18373085
366 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG200200.1

Sequence Viewer

Length: 366 bp
ATGATGCAAACTTCAAAGGAGCAAATGCAAGTACTAATCGAAAATCTGCAGTCGAAAGATAAAAATGAGTCCCTGCAACCAAAAGATGTCAATGAGTCTATATCCAAAGATAAGAATGAATCTCAGCAATCCAAAGGTAACAATGAATCTCTGCCATCAAAAGATAACAGAACAGGTCAGTTACGGTCTGAGCTTAAAAAGTTGGGGCTTTCTATTACTGATCGAGTGAAAGCATTAAGACTACTCATGGCTGATACTTGGAATGCTGATTTTTTTCTTACTTTGGATGAGGAAGAGAAATTGGAATTTGTAAAGCAACTCATTGATGAATCATCTAAGAAGGTGTATATTGTGGGTTATATTTGA

Protein Analysis

121

Amino Acids

13.94

Weight (kDa)

5.29

Isoelectric Point (pI)

46.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000261)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18411 FvH4_1g22560 FvH4_1g24290 FvH4_1g24290 FvH4_1g24290 FvH4_1g29434 FvH4_2g04031 FvH4_2g04811 FvH4_2g07610 FvH4_2g09412 FvH4_3g15552 FvH4_3g30720 FvH4_4g05810 FvH4_4g09541 FvH4_4g15171 FvH4_6g09145 FvH4_6g49541 FvH4_7g00320 FvH4_7g11552
malus_domestica MD00G1072400.v1.1 MD01G1188100.v1.1 MD07G1132000.v1.1 MD08G1190700.v1.1 MD10G1011200.v1.1 MD14G1164100.v1.1 MD15G1289200.v1.1 MD15G1289300.v1.1 MD17G1245100.v1.1
prunus_persica Prupe.6G228600_v2.0.a1
pyrus_communis pycom01g07070 pycom02g06890 pycom02g06900 pycom02g13930 pycom04g07470 pycom04g11770 pycom04g21930 pycom05g08520 pycom06g04490 pycom06g09560 pycom07g03750 pycom08g08760 pycom08g13660 pycom09g11520 pycom09g14250 pycom09g14770 pycom10g00720 pycom10g01290 pycom10g10480 pycom10g15700 pycom12420g00130 pycom12g05380 pycom12g08750 pycom13g19010 pycom13g29080 pycom14g06210 pycom14g13680 pycom14g19850 pycom15g22070 pycom15g23440 pycom15g24950 pycom15g25280 pycom16g11100 pycom16g17080 pycom16g26310 pycom17g15650 pycom17g15670 pycom17g20370
rosa_chinensis RchiOBHm_Chr1g0373591 RchiOBHm_Chr2g0105551 RchiOBHm_Chr2g0106711 RchiOBHm_Chr2g0106721 RchiOBHm_Chr7g0219611
rosa_laevigata RLG00000013773 RLG00000017436 RLG00000017533
rosa_multiflora Rmu_co8001842.1_g000001 Rmu_co8158450.1_g000001 Rmu_sc0000516.1_g000067 Rmu_sc0000566.1_g000009 Rmu_sc0000965.1_g000025 Rmu_sc0001718.1_g000001 Rmu_sc0001719.1_g000020 Rmu_sc0001822.1_g000025 Rmu_sc0002219.1_g000003 Rmu_sc0002460.1_g000059 Rmu_sc0002757.1_g000001 Rmu_sc0002860.1_g000001 Rmu_sc0004531.1_g000001 Rmu_sc0005558.1_g000003 Rmu_sc0011218.1_g000001 Rmu_sc0011998.1_g000003 Rmu_sc0015560.1_g000002 Rmu_sc0015560.1_g000003
rosa_roxburghii Rroxscaffold_1G00004200 Rroxscaffold_1G00026570 Rroxscaffold_1G00040370 Rroxscaffold_1G00044120 Rroxscaffold_1G00049590 Rroxscaffold_1G00059030 Rroxscaffold_2G00108440 Rroxscaffold_2G00108850 Rroxscaffold_2G00130680 Rroxscaffold_2G00132980 Rroxscaffold_2G00136860 Rroxscaffold_3G00218610 Rroxscaffold_4G00309940 Rroxscaffold_6G00405560
rosa_rugosa Rorug02G0138000 Rorug02G0138100 Rorug02G0138100 Rorug06G0154000
rosa_samantha Rh1AG121500 Rh1CG116300 Rh2AG189000 Rh2AG509600 Rh2BG200200 Rh2CG194100 Rh2DG195300 Rh5AG114400 Rh5DG488800
rosa_wichuraiana Rw0G022020 Rw1G023650 Rw1G026380 Rw1G034750 Rw1G040770 Rw2G014870 Rw2G016560 Rw4G031190 Rw5G026570 Rw6G003020 Rw6G012060 Rw7G014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 305
AfaI GTAC 1 cut(s) 33
AgsI TTSAA 1 cut(s) 15
AluBI AGCT 1 cut(s) 193
AluI AGCT 1 cut(s) 193
ApoI RAATTY 1 cut(s) 305
BccI CCATC 1 cut(s) 163
BfmI CTRYAG 1 cut(s) 47
BmcAI AGTACT 1 cut(s) 33
BseGI GGATG 1 cut(s) 292
BseMII CTCAG 2 cut(s) 137, 180
BslFI GGGAC 1 cut(s) 55
BsmFI GGGAC 1 cut(s) 55
BsmI GAATGC 1 cut(s) 268
Bsp143I GATC 1 cut(s) 220
BspCNI CTCAG 2 cut(s) 136, 181
BspMAI CTGCAG 1 cut(s) 51
BssMI GATC 1 cut(s) 220
Bst4CI ACNGT 1 cut(s) 186
Bst6I CTCTTC 1 cut(s) 288
BstDEI CTNAG 3 cut(s) 123, 189, 336
BstF5I GGATG 1 cut(s) 292
BstKTI GATC 1 cut(s) 223
BstMBI GATC 1 cut(s) 220
BstSFI CTRYAG 1 cut(s) 47
BtsCI GGATG 1 cut(s) 292
Csp6I GTAC 1 cut(s) 32
CviAII CATG 1 cut(s) 247
CviJI RGCY 3 cut(s) 193, 208, 251
CviKI_1 RGCY 3 cut(s) 193, 208, 251
CviQI GTAC 1 cut(s) 32
DdeI CTNAG 3 cut(s) 123, 189, 336
DpnI GATC 1 cut(s) 222
DpnII GATC 1 cut(s) 220
Eam1104I CTCTTC 1 cut(s) 288
EarI CTCTTC 1 cut(s) 288
FaeI CATG 1 cut(s) 250
FaiI YATR 4 cut(s) 101, 248, 348, 360
FaqI GGGAC 1 cut(s) 55
FatI CATG 1 cut(s) 246
FokI GGATG 1 cut(s) 299
Hin1II CATG 1 cut(s) 250
HinfI GANTC 5 cut(s) 68, 95, 119, 146, 329
Hpy188I TCNGA 1 cut(s) 190
HpyAV CCTTC 1 cut(s) 334
HpyCH4III ACNGT 1 cut(s) 186
HpyCH4V TGCA 4 cut(s) 7, 28, 49, 76
HpyF3I CTNAG 3 cut(s) 123, 189, 336
Hsp92II CATG 1 cut(s) 250
Kzo9I GATC 1 cut(s) 220
LmnI GCTCC 1 cut(s) 19
LpnPI CCDG 2 cut(s) 86, 159
MaeIII GTNAC 2 cut(s) 137, 180
MalI GATC 1 cut(s) 222
MboI GATC 1 cut(s) 220
MboII GAAGA 1 cut(s) 305
MluCI AATT 2 cut(s) 299, 305
MlyI GAGTC 2 cut(s) 77, 104
MnlI CCTC 1 cut(s) 283
MseI TTAA 2 cut(s) 195, 236
Mva1269I GAATGC 1 cut(s) 268
NdeII GATC 1 cut(s) 220
NlaIII CATG 1 cut(s) 250
PctI GAATGC 1 cut(s) 268
PfeI GAWTC 3 cut(s) 119, 146, 329
PleI GAGTC 2 cut(s) 76, 103
PpsI GAGTC 2 cut(s) 76, 103
PstI CTGCAG 1 cut(s) 51
RsaI GTAC 1 cut(s) 33
RsaNI GTAC 1 cut(s) 32
SaqAI TTAA 2 cut(s) 195, 236
Sau3AI GATC 1 cut(s) 220
ScaI AGTACT 1 cut(s) 33
SchI GAGTC 2 cut(s) 77, 104
SetI ASST 4 cut(s) 139, 178, 195, 345
SfcI CTRYAG 1 cut(s) 47
SgeI CNNG 6 cut(s) 41, 85, 186, 236, 259, 270
Sse9I AATT 2 cut(s) 299, 305
TaaI ACNGT 1 cut(s) 186
TaqI TCGA 3 cut(s) 39, 53, 223
TasI AATT 2 cut(s) 299, 305
TatI WGTACW 1 cut(s) 31
TfiI GAWTC 3 cut(s) 119, 146, 329
Tru1I TTAA 2 cut(s) 195, 236
Tru9I TTAA 2 cut(s) 195, 236
TspDTI ATGAA 3 cut(s) 132, 159, 342
XapI RAATTY 1 cut(s) 305
ZrmI AGTACT 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.