Rroxscaffold_1G00026570
MYB Family

isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0000261
Physical Location & Seq
Forward (+)
33444196 .. 33450949
6754 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00026570.1

Sequence Viewer

Length: 561 bp
ATGTCCCCGCTCTACTCCCAGCTTGAAATTCTGGTTGTGAGGGACCAGAAACATTACTATCATCGAAACATTCCTATCCTTTCCGGCATACGGTTCCAAATCAATAGCCATGTCAATCAAACTATGCCCATTTTTAGATTTCACGAAACCTCTCTTGGGAAACATATTCAAGCATCAAGACATCTTCACGTACCGGTCTTTACTCCCACATTAACTTCCAACGTCGATTTTCTAGTCGCCGGACATAACCATGCGGGAACCGGTGCTTGCATTCGTGTCTCCCATCACAAGGATGCTGATGGATGGAGGGGAAAACCATTCCCACGTTATGAAACATTTGCTCATATATTTGGAGTGGACCGTGCTATTGGAAAGGCTGCCAAAGTACCTGCTGCAATAGTAGAGGAAGTTAATGAAAAGCTTGAAAACCAAGAGCATGCTGATGCATTTGATTCTAAGGTAGAAGCGGACCAACTATCCACTGCTAAATGCGAGTCCACTTCTAAATCCGAGTCTACAAGCACGAGTAGGAGGAGGAAAGAGAGGATGATGATAACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

186

Amino Acids

21.04

Weight (kDa)

9.14

Isoelectric Point (pI)

49.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000261)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18411 FvH4_1g22560 FvH4_1g24290 FvH4_1g24290 FvH4_1g24290 FvH4_1g29434 FvH4_2g04031 FvH4_2g04811 FvH4_2g07610 FvH4_2g09412 FvH4_3g15552 FvH4_3g30720 FvH4_4g05810 FvH4_4g09541 FvH4_4g15171 FvH4_6g09145 FvH4_6g49541 FvH4_7g00320 FvH4_7g11552
malus_domestica MD00G1072400.v1.1 MD01G1188100.v1.1 MD07G1132000.v1.1 MD08G1190700.v1.1 MD10G1011200.v1.1 MD14G1164100.v1.1 MD15G1289200.v1.1 MD15G1289300.v1.1 MD17G1245100.v1.1
prunus_persica Prupe.6G228600_v2.0.a1
pyrus_communis pycom01g07070 pycom02g06890 pycom02g06900 pycom02g13930 pycom04g07470 pycom04g11770 pycom04g21930 pycom05g08520 pycom06g04490 pycom06g09560 pycom07g03750 pycom08g08760 pycom08g13660 pycom09g11520 pycom09g14250 pycom09g14770 pycom10g00720 pycom10g01290 pycom10g10480 pycom10g15700 pycom12420g00130 pycom12g05380 pycom12g08750 pycom13g19010 pycom13g29080 pycom14g06210 pycom14g13680 pycom14g19850 pycom15g22070 pycom15g23440 pycom15g24950 pycom15g25280 pycom16g11100 pycom16g17080 pycom16g26310 pycom17g15650 pycom17g15670 pycom17g20370
rosa_chinensis RchiOBHm_Chr1g0373591 RchiOBHm_Chr2g0105551 RchiOBHm_Chr2g0106711 RchiOBHm_Chr2g0106721 RchiOBHm_Chr7g0219611
rosa_laevigata RLG00000013773 RLG00000017436 RLG00000017533
rosa_multiflora Rmu_co8001842.1_g000001 Rmu_co8158450.1_g000001 Rmu_sc0000516.1_g000067 Rmu_sc0000566.1_g000009 Rmu_sc0000965.1_g000025 Rmu_sc0001718.1_g000001 Rmu_sc0001719.1_g000020 Rmu_sc0001822.1_g000025 Rmu_sc0002219.1_g000003 Rmu_sc0002460.1_g000059 Rmu_sc0002757.1_g000001 Rmu_sc0002860.1_g000001 Rmu_sc0004531.1_g000001 Rmu_sc0005558.1_g000003 Rmu_sc0011218.1_g000001 Rmu_sc0011998.1_g000003 Rmu_sc0015560.1_g000002 Rmu_sc0015560.1_g000003
rosa_roxburghii Rroxscaffold_1G00004200 Rroxscaffold_1G00026570 Rroxscaffold_1G00040370 Rroxscaffold_1G00044120 Rroxscaffold_1G00049590 Rroxscaffold_1G00059030 Rroxscaffold_2G00108440 Rroxscaffold_2G00108850 Rroxscaffold_2G00130680 Rroxscaffold_2G00132980 Rroxscaffold_2G00136860 Rroxscaffold_3G00218610 Rroxscaffold_4G00309940 Rroxscaffold_6G00405560
rosa_rugosa Rorug02G0138000 Rorug02G0138100 Rorug02G0138100 Rorug06G0154000
rosa_samantha Rh1AG121500 Rh1CG116300 Rh2AG189000 Rh2AG509600 Rh2BG200200 Rh2CG194100 Rh2DG195300 Rh5AG114400 Rh5DG488800
rosa_wichuraiana Rw0G022020 Rw1G023650 Rw1G026380 Rw1G034750 Rw1G040770 Rw2G014870 Rw2G016560 Rw4G031190 Rw5G026570 Rw6G003020 Rw6G012060 Rw7G014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 397
AccBSI CCGCTC 1 cut(s) 10
AccI GTMKAC 1 cut(s) 515
AciI CCGC 3 cut(s) 8, 254, 467
AcsI RAATTY 1 cut(s) 27
AfaI GTAC 2 cut(s) 192, 387
AfiI CCNNNNNNNGG 3 cut(s) 90, 156, 289
AgeI ACCGGT 2 cut(s) 193, 260
AgsI TTSAA 3 cut(s) 26, 170, 425
AjuI GAANNNNNNNTTGG 2 cut(s) 138, 170
AluBI AGCT 2 cut(s) 22, 421
AluI AGCT 2 cut(s) 22, 421
Alw26I GTCTC 1 cut(s) 283
ApeKI GCWGC 2 cut(s) 377, 392
ApoI RAATTY 1 cut(s) 27
AsiGI ACCGGT 2 cut(s) 193, 260
AspS9I GGNCC 3 cut(s) 43, 358, 469
AvaII GGWCC 3 cut(s) 43, 358, 469
BauI CACGAG 1 cut(s) 523
BbvI GCAGC 2 cut(s) 364, 379
BccI CCATC 3 cut(s) 291, 293, 297
BcoDI GTCTC 1 cut(s) 283
BfaI CTAG 1 cut(s) 233
BfuAI ACCTGC 1 cut(s) 397
BisI GCNGC 2 cut(s) 378, 393
BlsI GCNGC 2 cut(s) 379, 394
Bme18I GGWCC 3 cut(s) 43, 358, 469
BmgT120I GGNCC 3 cut(s) 43, 358, 469
BmiI GGNNCC 3 cut(s) 44, 95, 259
BmsI GCATC 3 cut(s) 182, 283, 433
BsaAI YACGTR 1 cut(s) 190
BsaWI WCCGGW 2 cut(s) 193, 260
Bsc4I CCNNNNNNNGG 3 cut(s) 90, 156, 289
Bse118I RCCGGY 2 cut(s) 193, 260
BseGI GGATG 3 cut(s) 298, 308, 552
BseLI CCNNNNNNNGG 3 cut(s) 90, 156, 289
BseRI GAGGAG 1 cut(s) 547
BseXI GCAGC 2 cut(s) 364, 379
BseYI CCCAGC 1 cut(s) 18
BshTI ACCGGT 2 cut(s) 193, 260
BsiSI CCGG 4 cut(s) 84, 194, 240, 261
BslFI GGGAC 1 cut(s) 56
BslI CCNNNNNNNGG 3 cut(s) 90, 156, 289
BsmAI GTCTC 1 cut(s) 283
BsmFI GGGAC 1 cut(s) 56
BsmI GAATGC 1 cut(s) 270
BspACI CCGC 3 cut(s) 8, 254, 467
BspLI GGNNCC 3 cut(s) 44, 95, 259
BspMI ACCTGC 1 cut(s) 397
BsrBI CCGCTC 1 cut(s) 10
BsrFI RCCGGY 2 cut(s) 193, 260
BssAI RCCGGY 2 cut(s) 193, 260
BssSI CACGAG 1 cut(s) 523
Bst2BI CACGAG 1 cut(s) 523
Bst4CI ACNGT 2 cut(s) 93, 362
BstBAI YACGTR 1 cut(s) 190
BstC8I GCNNGC 2 cut(s) 268, 438
BstDEI CTNAG 1 cut(s) 456
BstF5I GGATG 3 cut(s) 298, 308, 552
BstMAI GTCTC 1 cut(s) 283
BstNSI RCATGY 1 cut(s) 440
BstV1I GCAGC 2 cut(s) 364, 379
BtsCI GGATG 3 cut(s) 298, 308, 552
BtsI GCAGTG 1 cut(s) 480
BtsIMutI CAGTG 1 cut(s) 480
BveI ACCTGC 1 cut(s) 397
Cac8I GCNNGC 2 cut(s) 268, 438
Cfr10I RCCGGY 2 cut(s) 193, 260
Cfr13I GGNCC 3 cut(s) 43, 358, 469
Csp6I GTAC 2 cut(s) 191, 386
CspAI ACCGGT 2 cut(s) 193, 260
CviAII CATG 3 cut(s) 110, 251, 437
CviJI RGCY 4 cut(s) 22, 108, 377, 421
CviKI_1 RGCY 4 cut(s) 22, 108, 377, 421
CviQI GTAC 2 cut(s) 191, 386
DdeI CTNAG 1 cut(s) 456
Eco47I GGWCC 3 cut(s) 43, 358, 469
EcoT22I ATGCAT 1 cut(s) 448
FaeI CATG 3 cut(s) 113, 254, 440
FaqI GGGAC 1 cut(s) 56
FatI CATG 3 cut(s) 109, 250, 436
FauI CCCGC 2 cut(s) 15, 247
FblI GTMKAC 1 cut(s) 515
Fnu4HI GCNGC 2 cut(s) 378, 393
FokI GGATG 2 cut(s) 305, 315
Fsp4HI GCNGC 2 cut(s) 378, 393
FspBI CTAG 1 cut(s) 233
GluI GCNGC 2 cut(s) 378, 393
GsaI CCCAGC 1 cut(s) 22
HapII CCGG 4 cut(s) 84, 194, 240, 261
Hin1II CATG 3 cut(s) 113, 254, 440
HindIII AAGCTT 1 cut(s) 419
HinfI GANTC 3 cut(s) 452, 494, 512
HpaII CCGG 4 cut(s) 84, 194, 240, 261
Hpy166II GTNNAC 3 cut(s) 358, 498, 516
Hpy188I TCNGA 1 cut(s) 511
Hpy188III TCNNGA 2 cut(s) 143, 177
Hpy8I GTNNAC 3 cut(s) 358, 498, 516
Hpy99I CGWCG 1 cut(s) 227
HpyCH4III ACNGT 2 cut(s) 93, 362
HpyCH4IV ACGT 3 cut(s) 189, 222, 325
HpyCH4V TGCA 3 cut(s) 270, 395, 446
HpyF3I CTNAG 1 cut(s) 456
HpySE526I ACGT 3 cut(s) 189, 222, 325
Hsp92II CATG 3 cut(s) 113, 254, 440
LpnPI CCDG 8 cut(s) 17, 32, 59, 97, 207, 253, 274, 402
Lsp1109I GCAGC 2 cut(s) 364, 379
LweI GCATC 3 cut(s) 182, 283, 433
MaeI CTAG 1 cut(s) 233
MaeII ACGT 3 cut(s) 189, 222, 325
MbiI CCGCTC 1 cut(s) 10
MboII GAAGA 1 cut(s) 176
MluCI AATT 1 cut(s) 27
MlyI GAGTC 2 cut(s) 503, 521
MmeI TCCRAC 1 cut(s) 243
MnlI CCTC 7 cut(s) 33, 160, 300, 397, 525, 528, 537
Mph1103I ATGCAT 1 cut(s) 448
MseI TTAA 2 cut(s) 212, 411
MslI CAYNNNNRTG 3 cut(s) 249, 291, 441
MspI CCGG 4 cut(s) 84, 194, 240, 261
Mva1269I GAATGC 1 cut(s) 270
NlaIII CATG 3 cut(s) 113, 254, 440
NlaIV GGNNCC 3 cut(s) 44, 95, 259
NsiI ATGCAT 1 cut(s) 448
NspI RCATGY 1 cut(s) 440
PaeI GCATGC 1 cut(s) 440
PctI GAATGC 1 cut(s) 270
PfeI GAWTC 1 cut(s) 452
PinAI ACCGGT 2 cut(s) 193, 260
PkrI GCNGC 2 cut(s) 379, 394
PleI GAGTC 2 cut(s) 502, 520
PpsI GAGTC 2 cut(s) 502, 520
Ppu21I YACGTR 1 cut(s) 190
PspFI CCCAGC 1 cut(s) 18
PspN4I GGNNCC 3 cut(s) 44, 95, 259
PspPI GGNCC 3 cut(s) 43, 358, 469
RsaI GTAC 2 cut(s) 192, 387
RsaNI GTAC 2 cut(s) 191, 386
RseI CAYNNNNRTG 3 cut(s) 249, 291, 441
SaqAI TTAA 2 cut(s) 212, 411
SatI GCNGC 2 cut(s) 378, 393
Sau96I GGNCC 3 cut(s) 43, 358, 469
SchI GAGTC 2 cut(s) 503, 521
SetI ASST 8 cut(s) 24, 152, 192, 225, 328, 391, 423, 462
SfaNI GCATC 3 cut(s) 182, 283, 433
SinI GGWCC 3 cut(s) 43, 358, 469
SmiMI CAYNNNNRTG 3 cut(s) 249, 291, 441
SphI GCATGC 1 cut(s) 440
Sse9I AATT 1 cut(s) 27
SsiI CCGC 3 cut(s) 8, 254, 467
SspMI CTAG 1 cut(s) 233
TaaI ACNGT 2 cut(s) 93, 362
TaiI ACGT 3 cut(s) 192, 225, 328
TaqI TCGA 2 cut(s) 64, 225
TasI AATT 1 cut(s) 27
TfiI GAWTC 1 cut(s) 452
Tru1I TTAA 2 cut(s) 212, 411
Tru9I TTAA 2 cut(s) 212, 411
TscAI CASTG 1 cut(s) 487
TseI GCWGC 2 cut(s) 377, 392
TspDTI ATGAA 2 cut(s) 345, 429
TspRI CASTG 1 cut(s) 487
VpaK11BI GGWCC 3 cut(s) 43, 358, 469
XapI RAATTY 1 cut(s) 27
XceI RCATGY 1 cut(s) 440
XmiI GTMKAC 1 cut(s) 515
XspI CTAG 1 cut(s) 233
Zsp2I ATGCAT 1 cut(s) 448
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.