pycom15g22070
MYB Family

Myb/SANT-like DNA-binding domain

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
16151497 .. 16151991
495 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g22070.2

Sequence Viewer

Length: 417 bp
ATGGCTTCTTTGATAGATTATATGGCCACCTCACGTAATTGGATTGATCATGACAATGATGTACTACTTACCATCCTTGAGGAGATGGTAGTTGATGGTGTTAGGTGTGAGACCGGCAGTTTTAAGGCTGGTACATTTGTAATGGTTGCCACCAAGATGAGGGAGATGATTTCCGGCATTAATATAGAGCCAAAACATATACAAAACAAGCTGAAGCGTCTAAAAGAAAAGTATTCCTTTGCATATGACATGATGAATACCTCTAGATTTGGTTCGGATGACGAAAAAAAATGTGTTGTTATGGATAGTGACGATGTACTTCAGTTGTGGGTGAAGAAGCATCCTAATGCATCTTACAAACCAAACAAGCCATTTCCGTTGTATCCATGCTTGTGTACGGTGTTTGGGAGAGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

15.89

Weight (kDa)

6.82

Isoelectric Point (pI)

45.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000261)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18411 FvH4_1g22560 FvH4_1g24290 FvH4_1g24290 FvH4_1g24290 FvH4_1g29434 FvH4_2g04031 FvH4_2g04811 FvH4_2g07610 FvH4_2g09412 FvH4_3g15552 FvH4_3g30720 FvH4_4g05810 FvH4_4g09541 FvH4_4g15171 FvH4_6g09145 FvH4_6g49541 FvH4_7g00320 FvH4_7g11552
malus_domestica MD00G1072400.v1.1 MD01G1188100.v1.1 MD07G1132000.v1.1 MD08G1190700.v1.1 MD10G1011200.v1.1 MD14G1164100.v1.1 MD15G1289200.v1.1 MD15G1289300.v1.1 MD17G1245100.v1.1
prunus_persica Prupe.6G228600_v2.0.a1
pyrus_communis pycom01g07070 pycom02g06890 pycom02g06900 pycom02g13930 pycom04g07470 pycom04g11770 pycom04g21930 pycom05g08520 pycom06g04490 pycom06g09560 pycom07g03750 pycom08g08760 pycom08g13660 pycom09g11520 pycom09g14250 pycom09g14770 pycom10g00720 pycom10g01290 pycom10g10480 pycom10g15700 pycom12420g00130 pycom12g05380 pycom12g08750 pycom13g19010 pycom13g29080 pycom14g06210 pycom14g13680 pycom14g19850 pycom15g22070 pycom15g23440 pycom15g24950 pycom15g25280 pycom16g11100 pycom16g17080 pycom16g26310 pycom17g15650 pycom17g15670 pycom17g20370
rosa_chinensis RchiOBHm_Chr1g0373591 RchiOBHm_Chr2g0105551 RchiOBHm_Chr2g0106711 RchiOBHm_Chr2g0106721 RchiOBHm_Chr7g0219611
rosa_laevigata RLG00000013773 RLG00000017436 RLG00000017533
rosa_multiflora Rmu_co8001842.1_g000001 Rmu_co8158450.1_g000001 Rmu_sc0000516.1_g000067 Rmu_sc0000566.1_g000009 Rmu_sc0000965.1_g000025 Rmu_sc0001718.1_g000001 Rmu_sc0001719.1_g000020 Rmu_sc0001822.1_g000025 Rmu_sc0002219.1_g000003 Rmu_sc0002460.1_g000059 Rmu_sc0002757.1_g000001 Rmu_sc0002860.1_g000001 Rmu_sc0004531.1_g000001 Rmu_sc0005558.1_g000003 Rmu_sc0011218.1_g000001 Rmu_sc0011998.1_g000003 Rmu_sc0015560.1_g000002 Rmu_sc0015560.1_g000003
rosa_roxburghii Rroxscaffold_1G00004200 Rroxscaffold_1G00026570 Rroxscaffold_1G00040370 Rroxscaffold_1G00044120 Rroxscaffold_1G00049590 Rroxscaffold_1G00059030 Rroxscaffold_2G00108440 Rroxscaffold_2G00108850 Rroxscaffold_2G00130680 Rroxscaffold_2G00132980 Rroxscaffold_2G00136860 Rroxscaffold_3G00218610 Rroxscaffold_4G00309940 Rroxscaffold_6G00405560
rosa_rugosa Rorug02G0138000 Rorug02G0138100 Rorug02G0138100 Rorug06G0154000
rosa_samantha Rh1AG121500 Rh1CG116300 Rh2AG189000 Rh2AG509600 Rh2BG200200 Rh2CG194100 Rh2DG195300 Rh5AG114400 Rh5DG488800
rosa_wichuraiana Rw0G022020 Rw1G023650 Rw1G026380 Rw1G034750 Rw1G040770 Rw2G014870 Rw2G016560 Rw4G031190 Rw5G026570 Rw6G003020 Rw6G012060 Rw7G014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 24
AcuI CTGAAG 2 cut(s) 233, 305
AfaI GTAC 4 cut(s) 63, 133, 318, 397
AfiI CCNNNNNNNGG 1 cut(s) 159
AluBI AGCT 1 cut(s) 211
AluI AGCT 1 cut(s) 211
Alw26I GTCTC 2 cut(s) 104, 405
AoxI GGCC 1 cut(s) 24
AseI ATTAAT 1 cut(s) 180
AsuHPI GGTGA 1 cut(s) 343
BaeI ACNNNNGTAYC 2 cut(s) 123, 156
BalI TGGCCA 1 cut(s) 26
BccI CCATC 3 cut(s) 79, 80, 89
BciVI GTATCC 1 cut(s) 393
BclI TGATCA 1 cut(s) 46
BcoDI GTCTC 2 cut(s) 104, 405
BfaI CTAG 1 cut(s) 264
BfuI GTATCC 1 cut(s) 393
BmsI GCATC 2 cut(s) 349, 359
BpuEI CTTGAG 1 cut(s) 98
BsaAI YACGTR 1 cut(s) 35
BsaI GGTCTC 1 cut(s) 104
Bsc4I CCNNNNNNNGG 1 cut(s) 159
Bse118I RCCGGY 1 cut(s) 113
BseGI GGATG 3 cut(s) 72, 283, 340
BseLI CCNNNNNNNGG 1 cut(s) 159
BseRI GAGGAG 1 cut(s) 95
BshFI GGCC 1 cut(s) 26
BsiSI CCGG 2 cut(s) 114, 174
BslI CCNNNNNNNGG 1 cut(s) 159
BsmAI GTCTC 2 cut(s) 104, 405
BsnI GGCC 1 cut(s) 26
Bso31I GGTCTC 1 cut(s) 104
Bsp143I GATC 1 cut(s) 46
BspANI GGCC 1 cut(s) 26
BspHI TCATGA 1 cut(s) 49
BspTNI GGTCTC 1 cut(s) 104
BsrFI RCCGGY 1 cut(s) 113
BssAI RCCGGY 1 cut(s) 113
BssMI GATC 1 cut(s) 46
Bst4CI ACNGT 1 cut(s) 400
BstBAI YACGTR 1 cut(s) 35
BstF5I GGATG 3 cut(s) 72, 283, 340
BstKTI GATC 1 cut(s) 49
BstMAI GTCTC 2 cut(s) 104, 405
BstMBI GATC 1 cut(s) 46
BsuI GTATCC 1 cut(s) 393
BsuRI GGCC 1 cut(s) 26
BtsCI GGATG 3 cut(s) 72, 283, 340
CciI TCATGA 1 cut(s) 49
Cfr10I RCCGGY 1 cut(s) 113
CseI GACGC 1 cut(s) 206
Csp6I GTAC 4 cut(s) 62, 132, 317, 396
CviAII CATG 3 cut(s) 50, 250, 387
CviJI RGCY 6 cut(s) 5, 26, 128, 190, 211, 370
CviKI_1 RGCY 6 cut(s) 5, 26, 128, 190, 211, 370
CviQI GTAC 4 cut(s) 62, 132, 317, 396
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
EaeI YGGCCR 1 cut(s) 24
Eco31I GGTCTC 1 cut(s) 104
Eco57I CTGAAG 2 cut(s) 233, 305
EcoT22I ATGCAT 1 cut(s) 352
FaeI CATG 3 cut(s) 53, 253, 390
FalI AAGNNNNNCTT 2 cut(s) 221, 253
FatI CATG 3 cut(s) 49, 249, 386
FauNDI CATATG 1 cut(s) 244
FbaI TGATCA 1 cut(s) 46
FokI GGATG 3 cut(s) 59, 290, 327
FspBI CTAG 1 cut(s) 264
HaeIII GGCC 1 cut(s) 26
HapII CCGG 2 cut(s) 114, 174
HgaI GACGC 1 cut(s) 206
Hin1II CATG 3 cut(s) 53, 253, 390
HpaII CCGG 2 cut(s) 114, 174
HphI GGTGA 1 cut(s) 343
Hpy166II GTNNAC 1 cut(s) 396
Hpy188I TCNGA 1 cut(s) 277
Hpy188III TCNNGA 2 cut(s) 50, 264
Hpy8I GTNNAC 1 cut(s) 396
HpyCH4III ACNGT 1 cut(s) 400
HpyCH4IV ACGT 1 cut(s) 34
HpyCH4V TGCA 2 cut(s) 242, 350
HpySE526I ACGT 1 cut(s) 34
Hsp92II CATG 3 cut(s) 53, 253, 390
Ksp22I TGATCA 1 cut(s) 46
Kzo9I GATC 1 cut(s) 46
LpnPI CCDG 3 cut(s) 114, 127, 187
LweI GCATC 2 cut(s) 349, 359
MaeI CTAG 1 cut(s) 264
MaeII ACGT 1 cut(s) 34
MaeIII GTNAC 1 cut(s) 308
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 1 cut(s) 346
MlsI TGGCCA 1 cut(s) 26
MluCI AATT 1 cut(s) 37
MluNI TGGCCA 1 cut(s) 26
MnlI CCTC 4 cut(s) 40, 73, 153, 271
Mox20I TGGCCA 1 cut(s) 26
Mph1103I ATGCAT 1 cut(s) 352
MscI TGGCCA 1 cut(s) 26
MseI TTAA 2 cut(s) 123, 180
MslI CAYNNNNRTG 4 cut(s) 54, 155, 345, 391
Msp20I TGGCCA 1 cut(s) 26
MspI CCGG 2 cut(s) 114, 174
NdeI CATATG 1 cut(s) 244
NdeII GATC 1 cut(s) 46
NlaIII CATG 3 cut(s) 53, 253, 390
NmuCI GTSAC 1 cut(s) 308
NsiI ATGCAT 1 cut(s) 352
PagI TCATGA 1 cut(s) 49
Ppu21I YACGTR 1 cut(s) 35
PshBI ATTAAT 1 cut(s) 180
RsaI GTAC 4 cut(s) 63, 133, 318, 397
RsaNI GTAC 4 cut(s) 62, 132, 317, 396
RseI CAYNNNNRTG 4 cut(s) 54, 155, 345, 391
SaqAI TTAA 2 cut(s) 123, 180
Sau3AI GATC 1 cut(s) 46
SetI ASST 5 cut(s) 32, 37, 107, 213, 263
SfaNI GCATC 2 cut(s) 349, 359
SmiMI CAYNNNNRTG 4 cut(s) 54, 155, 345, 391
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 1 cut(s) 37
SspMI CTAG 1 cut(s) 264
TaaI ACNGT 1 cut(s) 400
TaiI ACGT 1 cut(s) 37
TasI AATT 1 cut(s) 37
TatI WGTACW 2 cut(s) 61, 316
Tru1I TTAA 2 cut(s) 123, 180
Tru9I TTAA 2 cut(s) 123, 180
TseFI GTSAC 1 cut(s) 308
Tsp45I GTSAC 1 cut(s) 308
TspDTI ATGAA 1 cut(s) 269
TspGWI ACGGA 1 cut(s) 366
VspI ATTAAT 1 cut(s) 180
XbaI TCTAGA 1 cut(s) 263
XspI CTAG 1 cut(s) 264
Zsp2I ATGCAT 1 cut(s) 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.