Rmu_co8001842.1_g000001
MYB Family

nuclease HARBI1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8001842.1
Physical Location & Seq
Forward (+)
1 .. 285
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8001842.1_g000001.1.cds

Sequence Viewer

Length: 285 bp
agaaatgatgaagataaaattatgcttgcattggataaattgtttgaagaatctggaaaaagaatgcaagcagtgactgatgccatagtgaaaggtaatgaagatcgatctgatattgctaaggaacttaagaaaatgagattttctgttctagaccaaattgaggcattaaaaatcattttggataatccccaaaacatatctgtgttcatgtccttagatgatgaagtgaggaaagtgtatgtcgagaacttgcttgcggtcactgctagaggatctacctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.69

Weight (kDa)

4.96

Isoelectric Point (pI)

33.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000261)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18411 FvH4_1g22560 FvH4_1g24290 FvH4_1g24290 FvH4_1g24290 FvH4_1g29434 FvH4_2g04031 FvH4_2g04811 FvH4_2g07610 FvH4_2g09412 FvH4_3g15552 FvH4_3g30720 FvH4_4g05810 FvH4_4g09541 FvH4_4g15171 FvH4_6g09145 FvH4_6g49541 FvH4_7g00320 FvH4_7g11552
malus_domestica MD00G1072400.v1.1 MD01G1188100.v1.1 MD07G1132000.v1.1 MD08G1190700.v1.1 MD10G1011200.v1.1 MD14G1164100.v1.1 MD15G1289200.v1.1 MD15G1289300.v1.1 MD17G1245100.v1.1
prunus_persica Prupe.6G228600_v2.0.a1
pyrus_communis pycom01g07070 pycom02g06890 pycom02g06900 pycom02g13930 pycom04g07470 pycom04g11770 pycom04g21930 pycom05g08520 pycom06g04490 pycom06g09560 pycom07g03750 pycom08g08760 pycom08g13660 pycom09g11520 pycom09g14250 pycom09g14770 pycom10g00720 pycom10g01290 pycom10g10480 pycom10g15700 pycom12420g00130 pycom12g05380 pycom12g08750 pycom13g19010 pycom13g29080 pycom14g06210 pycom14g13680 pycom14g19850 pycom15g22070 pycom15g23440 pycom15g24950 pycom15g25280 pycom16g11100 pycom16g17080 pycom16g26310 pycom17g15650 pycom17g15670 pycom17g20370
rosa_chinensis RchiOBHm_Chr1g0373591 RchiOBHm_Chr2g0105551 RchiOBHm_Chr2g0106711 RchiOBHm_Chr2g0106721 RchiOBHm_Chr7g0219611
rosa_laevigata RLG00000013773 RLG00000017436 RLG00000017533
rosa_multiflora Rmu_co8001842.1_g000001 Rmu_co8158450.1_g000001 Rmu_sc0000516.1_g000067 Rmu_sc0000566.1_g000009 Rmu_sc0000965.1_g000025 Rmu_sc0001718.1_g000001 Rmu_sc0001719.1_g000020 Rmu_sc0001822.1_g000025 Rmu_sc0002219.1_g000003 Rmu_sc0002460.1_g000059 Rmu_sc0002757.1_g000001 Rmu_sc0002860.1_g000001 Rmu_sc0004531.1_g000001 Rmu_sc0005558.1_g000003 Rmu_sc0011218.1_g000001 Rmu_sc0011998.1_g000003 Rmu_sc0015560.1_g000002 Rmu_sc0015560.1_g000003
rosa_roxburghii Rroxscaffold_1G00004200 Rroxscaffold_1G00026570 Rroxscaffold_1G00040370 Rroxscaffold_1G00044120 Rroxscaffold_1G00049590 Rroxscaffold_1G00059030 Rroxscaffold_2G00108440 Rroxscaffold_2G00108850 Rroxscaffold_2G00130680 Rroxscaffold_2G00132980 Rroxscaffold_2G00136860 Rroxscaffold_3G00218610 Rroxscaffold_4G00309940 Rroxscaffold_6G00405560
rosa_rugosa Rorug02G0138000 Rorug02G0138100 Rorug02G0138100 Rorug06G0154000
rosa_samantha Rh1AG121500 Rh1CG116300 Rh2AG189000 Rh2AG509600 Rh2BG200200 Rh2CG194100 Rh2DG195300 Rh5AG114400 Rh5DG488800
rosa_wichuraiana Rw0G022020 Rw1G023650 Rw1G026380 Rw1G034750 Rw1G040770 Rw2G014870 Rw2G016560 Rw4G031190 Rw5G026570 Rw6G003020 Rw6G012060 Rw7G014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 260
AclWI GGATC 1 cut(s) 283
AfiI CCNNNNNNNGG 1 cut(s) 163
AflII CTTAAG 1 cut(s) 128
AgsI TTSAA 1 cut(s) 47
AlwI GGATC 1 cut(s) 283
AlwNI CAGNNNCTG 1 cut(s) 77
BfaI CTAG 3 cut(s) 152, 270, 283
BfrI CTTAAG 1 cut(s) 128
BmsI GCATC 1 cut(s) 70
Bpu10I CCTNAGC 1 cut(s) 120
Bsa29I ATCGAT 1 cut(s) 106
Bsc4I CCNNNNNNNGG 1 cut(s) 163
BseCI ATCGAT 1 cut(s) 106
BseLI CCNNNNNNNGG 1 cut(s) 163
BshVI ATCGAT 1 cut(s) 106
BslI CCNNNNNNNGG 1 cut(s) 163
BsmI GAATGC 1 cut(s) 69
Bsp143I GATC 3 cut(s) 103, 107, 275
BspACI CCGC 1 cut(s) 260
BspDI ATCGAT 1 cut(s) 106
BspPI GGATC 1 cut(s) 283
BspTI CTTAAG 1 cut(s) 128
BssMI GATC 3 cut(s) 103, 107, 275
BstAFI CTTAAG 1 cut(s) 128
BstC8I GCNNGC 3 cut(s) 27, 69, 258
BstDEI CTNAG 2 cut(s) 120, 217
BstKTI GATC 3 cut(s) 106, 110, 278
BstMBI GATC 3 cut(s) 103, 107, 275
BstMWI GCNNNNNNNGC 1 cut(s) 266
BstX2I RGATCY 1 cut(s) 275
BstYI RGATCY 1 cut(s) 275
Bsu15I ATCGAT 1 cut(s) 106
BsuTUI ATCGAT 1 cut(s) 106
BtsI GCAGTG 2 cut(s) 78, 264
BtsIMutI CAGTG 2 cut(s) 78, 264
Cac8I GCNNGC 3 cut(s) 27, 69, 258
CaiI CAGNNNCTG 1 cut(s) 77
ClaI ATCGAT 1 cut(s) 106
CviAII CATG 1 cut(s) 211
DdeI CTNAG 2 cut(s) 120, 217
DpnI GATC 3 cut(s) 105, 109, 277
DpnII GATC 3 cut(s) 103, 107, 275
FaeI CATG 1 cut(s) 214
FaiI YATR 5 cut(s) 23, 86, 200, 212, 243
FatI CATG 1 cut(s) 210
FspBI CTAG 3 cut(s) 152, 270, 283
Hin1II CATG 1 cut(s) 214
HinfI GANTC 1 cut(s) 50
Hpy188I TCNGA 1 cut(s) 112
Hpy188III TCNNGA 3 cut(s) 54, 152, 247
HpyCH4V TGCA 2 cut(s) 29, 67
HpyF10VI GCNNNNNNNGC 1 cut(s) 266
HpyF3I CTNAG 2 cut(s) 120, 217
Hsp92II CATG 1 cut(s) 214
Kzo9I GATC 3 cut(s) 103, 107, 275
LpnPI CCDG 1 cut(s) 39
LweI GCATC 1 cut(s) 70
MaeI CTAG 3 cut(s) 152, 270, 283
MaeIII GTNAC 2 cut(s) 73, 262
MalI GATC 3 cut(s) 105, 109, 277
MboI GATC 3 cut(s) 103, 107, 275
MboII GAAGA 3 cut(s) 23, 59, 113
MflI RGATCY 1 cut(s) 275
MluCI AATT 3 cut(s) 18, 38, 159
MnlI CCTC 3 cut(s) 157, 225, 266
MseI TTAA 2 cut(s) 129, 170
MslI CAYNNNNRTG 1 cut(s) 203
MspCI CTTAAG 1 cut(s) 128
Mva1269I GAATGC 1 cut(s) 69
MwoI GCNNNNNNNGC 1 cut(s) 266
NdeII GATC 3 cut(s) 103, 107, 275
NlaIII CATG 1 cut(s) 214
NmuCI GTSAC 2 cut(s) 73, 262
PctI GAATGC 1 cut(s) 69
PfeI GAWTC 1 cut(s) 50
PstNI CAGNNNCTG 1 cut(s) 77
PsuI RGATCY 1 cut(s) 275
RseI CAYNNNNRTG 1 cut(s) 203
SaqAI TTAA 2 cut(s) 129, 170
Sau3AI GATC 3 cut(s) 103, 107, 275
SetI ASST 2 cut(s) 97, 284
SfaNI GCATC 1 cut(s) 70
SgeI CNNG 8 cut(s) 38, 66, 80, 164, 223, 259, 265, 269
SmiMI CAYNNNNRTG 1 cut(s) 203
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
Sse9I AATT 3 cut(s) 18, 38, 159
SsiI CCGC 1 cut(s) 260
SspMI CTAG 3 cut(s) 152, 270, 283
TaqI TCGA 2 cut(s) 106, 246
TasI AATT 3 cut(s) 18, 38, 159
TfiI GAWTC 1 cut(s) 50
Tru1I TTAA 2 cut(s) 129, 170
Tru9I TTAA 2 cut(s) 129, 170
TscAI CASTG 2 cut(s) 78, 271
TseFI GTSAC 2 cut(s) 73, 262
Tsp45I GTSAC 2 cut(s) 73, 262
TspDTI ATGAA 4 cut(s) 24, 114, 199, 240
TspRI CASTG 2 cut(s) 78, 271
Vha464I CTTAAG 1 cut(s) 128
XbaI TCTAGA 1 cut(s) 151
XspI CTAG 3 cut(s) 152, 270, 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.