Rmu_sc0000566.1_g000009
MYB Family

nuclease HARBI1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000566.1
OG0000261
Physical Location & Seq
Reverse (-)
37651 .. 38593
943 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000566.1_g000009.1.cds

Sequence Viewer

Length: 588 bp
atggaaagtgatgatgaaaatacagagcaagggaagtcaaggcgtgtatggactagctttgaagaagaatctttgttgaatgttcttgatggaattattgctggaggacaacgctgcgacactggaagtttcaaatctgctaccatctttgggagtgaccatgcgactggaactggagctgaggtccctgctgatatgatggaggagcagagtaacaatgaagacggcattgaagttgagaatgacacaagccccatgtcaatgagcacaggacaatctcacgttagtcagaaaaagaggaaaagaaatgatgaagataaaataatacttgcattggataaattgtttgaagaatctggaaaaagaatgcaagcagtgactgatgctatagtgaaaggtaatgaagatcgatctgatattgctaaggaacttaagaaaatgggactttctgttctagaccaaattgaggcattgaaaatcattttggataagccccaaaatatctctgtattcatgtccttagatgatgaagtgcgaaaagtgtatgtggataatttgcttgtgggcactgatagaggatctacataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

195

Amino Acids

21.52

Weight (kDa)

4.56

Isoelectric Point (pI)

48.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000261)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18411 FvH4_1g22560 FvH4_1g24290 FvH4_1g24290 FvH4_1g24290 FvH4_1g29434 FvH4_2g04031 FvH4_2g04811 FvH4_2g07610 FvH4_2g09412 FvH4_3g15552 FvH4_3g30720 FvH4_4g05810 FvH4_4g09541 FvH4_4g15171 FvH4_6g09145 FvH4_6g49541 FvH4_7g00320 FvH4_7g11552
malus_domestica MD00G1072400.v1.1 MD01G1188100.v1.1 MD07G1132000.v1.1 MD08G1190700.v1.1 MD10G1011200.v1.1 MD14G1164100.v1.1 MD15G1289200.v1.1 MD15G1289300.v1.1 MD17G1245100.v1.1
prunus_persica Prupe.6G228600_v2.0.a1
pyrus_communis pycom01g07070 pycom02g06890 pycom02g06900 pycom02g13930 pycom04g07470 pycom04g11770 pycom04g21930 pycom05g08520 pycom06g04490 pycom06g09560 pycom07g03750 pycom08g08760 pycom08g13660 pycom09g11520 pycom09g14250 pycom09g14770 pycom10g00720 pycom10g01290 pycom10g10480 pycom10g15700 pycom12420g00130 pycom12g05380 pycom12g08750 pycom13g19010 pycom13g29080 pycom14g06210 pycom14g13680 pycom14g19850 pycom15g22070 pycom15g23440 pycom15g24950 pycom15g25280 pycom16g11100 pycom16g17080 pycom16g26310 pycom17g15650 pycom17g15670 pycom17g20370
rosa_chinensis RchiOBHm_Chr1g0373591 RchiOBHm_Chr2g0105551 RchiOBHm_Chr2g0106711 RchiOBHm_Chr2g0106721 RchiOBHm_Chr7g0219611
rosa_laevigata RLG00000013773 RLG00000017436 RLG00000017533
rosa_multiflora Rmu_co8001842.1_g000001 Rmu_co8158450.1_g000001 Rmu_sc0000516.1_g000067 Rmu_sc0000566.1_g000009 Rmu_sc0000965.1_g000025 Rmu_sc0001718.1_g000001 Rmu_sc0001719.1_g000020 Rmu_sc0001822.1_g000025 Rmu_sc0002219.1_g000003 Rmu_sc0002460.1_g000059 Rmu_sc0002757.1_g000001 Rmu_sc0002860.1_g000001 Rmu_sc0004531.1_g000001 Rmu_sc0005558.1_g000003 Rmu_sc0011218.1_g000001 Rmu_sc0011998.1_g000003 Rmu_sc0015560.1_g000002 Rmu_sc0015560.1_g000003
rosa_roxburghii Rroxscaffold_1G00004200 Rroxscaffold_1G00026570 Rroxscaffold_1G00040370 Rroxscaffold_1G00044120 Rroxscaffold_1G00049590 Rroxscaffold_1G00059030 Rroxscaffold_2G00108440 Rroxscaffold_2G00108850 Rroxscaffold_2G00130680 Rroxscaffold_2G00132980 Rroxscaffold_2G00136860 Rroxscaffold_3G00218610 Rroxscaffold_4G00309940 Rroxscaffold_6G00405560
rosa_rugosa Rorug02G0138000 Rorug02G0138100 Rorug02G0138100 Rorug06G0154000
rosa_samantha Rh1AG121500 Rh1CG116300 Rh2AG189000 Rh2AG509600 Rh2BG200200 Rh2CG194100 Rh2DG195300 Rh5AG114400 Rh5DG488800
rosa_wichuraiana Rw0G022020 Rw1G023650 Rw1G026380 Rw1G034750 Rw1G040770 Rw2G014870 Rw2G016560 Rw4G031190 Rw5G026570 Rw6G003020 Rw6G012060 Rw7G014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 586
AfiI CCNNNNNNNGG 2 cut(s) 150, 466
AflII CTTAAG 1 cut(s) 431
AgsI TTSAA 6 cut(s) 62, 79, 133, 233, 350, 475
AjuI GAANNNNNNNTTGG 2 cut(s) 467, 499
AloI GAACNNNNNNTCC 2 cut(s) 435, 467
AluBI AGCT 2 cut(s) 57, 179
AluI AGCT 2 cut(s) 57, 179
Alw21I GWGCWC 1 cut(s) 269
AlwI GGATC 1 cut(s) 586
AlwNI CAGNNNCTG 1 cut(s) 380
ApeKI GCWGC 1 cut(s) 114
AspS9I GGNCC 1 cut(s) 184
AvaII GGWCC 1 cut(s) 184
BaeGI GKGCMC 1 cut(s) 569
BbsI GAAGAC 1 cut(s) 228
Bbv12I GWGCWC 1 cut(s) 269
BbvCI CCTCAGC 1 cut(s) 180
BbvI GCAGC 1 cut(s) 101
BccI CCATC 3 cut(s) 83, 152, 193
BceAI ACGGC 1 cut(s) 241
BfaI CTAG 2 cut(s) 54, 455
BfmI CTRYAG 1 cut(s) 387
BfrI CTTAAG 1 cut(s) 431
BisI GCNGC 1 cut(s) 115
BlsI GCNGC 1 cut(s) 116
Bme18I GGWCC 1 cut(s) 184
BmgT120I GGNCC 1 cut(s) 184
BmiI GGNNCC 1 cut(s) 186
BmsI GCATC 1 cut(s) 373
BpiI GAAGAC 1 cut(s) 228
BpmI CTGGAG 2 cut(s) 123, 195
Bpu10I CCTNAGC 2 cut(s) 180, 423
Bsa29I ATCGAT 1 cut(s) 409
BsaXI ACNNNNNCTCC 2 cut(s) 168, 198
Bsc4I CCNNNNNNNGG 2 cut(s) 150, 466
Bse1I ACTGG 3 cut(s) 127, 172, 178
BseCI ATCGAT 1 cut(s) 409
BseLI CCNNNNNNNGG 2 cut(s) 150, 466
BseMII CTCAG 1 cut(s) 171
BseNI ACTGG 3 cut(s) 127, 172, 178
BseRI GAGGAG 1 cut(s) 218
BseSI GKGCMC 1 cut(s) 569
BseXI GCAGC 1 cut(s) 101
BshVI ATCGAT 1 cut(s) 409
BsiHKAI GWGCWC 1 cut(s) 269
BslFI GGGAC 2 cut(s) 170, 456
BslI CCNNNNNNNGG 2 cut(s) 150, 466
BsmFI GGGAC 2 cut(s) 170, 456
BsmI GAATGC 1 cut(s) 372
Bsp1286I GDGCHC 2 cut(s) 269, 569
Bsp143I GATC 3 cut(s) 406, 410, 578
BspCNI CTCAG 1 cut(s) 172
BspDI ATCGAT 1 cut(s) 409
BspLI GGNNCC 1 cut(s) 186
BspPI GGATC 1 cut(s) 586
BspTI CTTAAG 1 cut(s) 431
BsrI ACTGG 3 cut(s) 127, 172, 178
BssMI GATC 3 cut(s) 406, 410, 578
BstAFI CTTAAG 1 cut(s) 431
BstC8I GCNNGC 1 cut(s) 372
BstDEI CTNAG 3 cut(s) 180, 423, 520
BstKTI GATC 3 cut(s) 409, 413, 581
BstMBI GATC 3 cut(s) 406, 410, 578
BstSFI CTRYAG 1 cut(s) 387
BstSLI GKGCMC 1 cut(s) 569
BstV1I GCAGC 1 cut(s) 101
BstV2I GAAGAC 1 cut(s) 228
BstX2I RGATCY 1 cut(s) 578
BstXI CCANNNNNNTGG 1 cut(s) 167
BstYI RGATCY 1 cut(s) 578
Bsu15I ATCGAT 1 cut(s) 409
BsuTUI ATCGAT 1 cut(s) 409
BtsI GCAGTG 1 cut(s) 381
BtsIMutI CAGTG 3 cut(s) 120, 381, 567
Cac8I GCNNGC 1 cut(s) 372
CaiI CAGNNNCTG 1 cut(s) 380
Cfr13I GGNCC 1 cut(s) 184
ClaI ATCGAT 1 cut(s) 409
CviAII CATG 3 cut(s) 161, 256, 514
CviJI RGCY 4 cut(s) 57, 179, 252, 493
CviKI_1 RGCY 4 cut(s) 57, 179, 252, 493
DdeI CTNAG 3 cut(s) 180, 423, 520
DpnI GATC 3 cut(s) 408, 412, 580
DpnII GATC 3 cut(s) 406, 410, 578
Eco47I GGWCC 1 cut(s) 184
EcoO109I RGGNCCY 1 cut(s) 184
FaeI CATG 3 cut(s) 164, 259, 517
FaiI YATR 8 cut(s) 49, 162, 197, 257, 389, 515, 546, 586
FaqI GGGAC 2 cut(s) 170, 456
FatI CATG 3 cut(s) 160, 255, 513
Fnu4HI GCNGC 1 cut(s) 115
Fsp4HI GCNGC 1 cut(s) 115
FspBI CTAG 2 cut(s) 54, 455
GluI GCNGC 1 cut(s) 115
GsuI CTGGAG 2 cut(s) 123, 195
Hin1II CATG 3 cut(s) 164, 259, 517
HinfI GANTC 2 cut(s) 68, 353
Hpy188I TCNGA 2 cut(s) 291, 415
Hpy188III TCNNGA 3 cut(s) 86, 357, 455
HpyCH4IV ACGT 1 cut(s) 282
HpyCH4V TGCA 2 cut(s) 332, 370
HpyF3I CTNAG 3 cut(s) 180, 423, 520
HpySE526I ACGT 1 cut(s) 282
Hsp92II CATG 3 cut(s) 164, 259, 517
Kzo9I GATC 3 cut(s) 406, 410, 578
LmnI GCTCC 2 cut(s) 176, 205
LpnPI CCDG 7 cut(s) 87, 108, 153, 159, 201, 255, 342
Lsp1109I GCAGC 1 cut(s) 101
LweI GCATC 1 cut(s) 373
MaeI CTAG 2 cut(s) 54, 455
MaeII ACGT 1 cut(s) 282
MaeIII GTNAC 3 cut(s) 155, 212, 376
MalI GATC 3 cut(s) 408, 412, 580
MboI GATC 3 cut(s) 406, 410, 578
MboII GAAGA 6 cut(s) 74, 77, 233, 326, 362, 416
MflI RGATCY 1 cut(s) 578
MhlI GDGCHC 2 cut(s) 269, 569
MluCI AATT 4 cut(s) 93, 341, 462, 553
MnlI CCTC 6 cut(s) 98, 175, 196, 291, 460, 569
MseI TTAA 1 cut(s) 432
MslI CAYNNNNRTG 1 cut(s) 260
MspCI CTTAAG 1 cut(s) 431
Mva1269I GAATGC 1 cut(s) 372
NdeII GATC 3 cut(s) 406, 410, 578
NlaIII CATG 3 cut(s) 164, 259, 517
NlaIV GGNNCC 1 cut(s) 186
NmuCI GTSAC 2 cut(s) 155, 376
PctI GAATGC 1 cut(s) 372
PfeI GAWTC 2 cut(s) 68, 353
PkrI GCNGC 1 cut(s) 116
PpuMI RGGWCCY 1 cut(s) 184
Psp5II RGGWCCY 1 cut(s) 184
PspN4I GGNNCC 1 cut(s) 186
PspPI GGNCC 1 cut(s) 184
PspPPI RGGWCCY 1 cut(s) 184
PstNI CAGNNNCTG 1 cut(s) 380
PsuI RGATCY 1 cut(s) 578
RseI CAYNNNNRTG 1 cut(s) 260
SaqAI TTAA 1 cut(s) 432
SatI GCNGC 1 cut(s) 115
Sau3AI GATC 3 cut(s) 406, 410, 578
Sau96I GGNCC 1 cut(s) 184
SduI GDGCHC 2 cut(s) 269, 569
SetI ASST 5 cut(s) 59, 181, 186, 285, 400
SfaNI GCATC 1 cut(s) 373
SfcI CTRYAG 1 cut(s) 387
SinI GGWCC 1 cut(s) 184
SmiMI CAYNNNNRTG 1 cut(s) 260
SmlI CTYRAG 1 cut(s) 431
SmoI CTYRAG 1 cut(s) 431
Sse9I AATT 4 cut(s) 93, 341, 462, 553
SspMI CTAG 2 cut(s) 54, 455
TaiI ACGT 1 cut(s) 285
TaqI TCGA 1 cut(s) 409
TasI AATT 4 cut(s) 93, 341, 462, 553
TfiI GAWTC 2 cut(s) 68, 353
Tru1I TTAA 1 cut(s) 432
Tru9I TTAA 1 cut(s) 432
TscAI CASTG 3 cut(s) 127, 381, 574
TseFI GTSAC 2 cut(s) 155, 376
TseI GCWGC 1 cut(s) 114
Tsp45I GTSAC 2 cut(s) 155, 376
TspDTI ATGAA 6 cut(s) 30, 234, 327, 417, 502, 543
TspRI CASTG 3 cut(s) 127, 381, 574
Vha464I CTTAAG 1 cut(s) 431
VpaK11BI GGWCC 1 cut(s) 184
XbaI TCTAGA 1 cut(s) 454
XspI CTAG 2 cut(s) 54, 455
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.