Rmu_sc0000965.1_g000025
MYB Family

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000965.1
Physical Location & Seq
Forward (+)
107123 .. 107992
870 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000965.1_g000025.1.cds

Sequence Viewer

Length: 678 bp
atggattctgaagatagtcttataagtgatagaaaaaagagagaaagacgtgtatggacagatgagcaggaagatactcttctaaacatcctagaagaacttgttgcaaatggtcatgctcgtaaaaatggcacattcaaacctggtacatcaattatgatagagaatgctttactggataaatttcccaattctggactaaagtatagtccacatgttgagtcaaagattaaggactttaagaaaaaatatgctgtggtatatgacatgctccaaaaaagtggatttggatggaatgatgtgaggaagtgcgttgaggttgacaatgatgaggcatggtatgcatatgtcaagcatcacaaggatgctgatggatggaggggcaaaccattcccacgttatgaaacatttgctcatatatttggagtggaccgtgctattggaaaggctgccaaagtacctgctgcaatagtagaggaagttaatgaagagcttgaaaaccaagagcatgctgatgcatttgattctaaggtagaagcagaccaactatccactgctaaatctgagtccacttctaaattcgagtctacaagcacgagtaggaggaggaaaagagaggatgatgataacatagttcgtggcttagacaagtttgctgcaacattcaaagaagtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

225

Amino Acids

25.78

Weight (kDa)

5.78

Isoelectric Point (pI)

44.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000261)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18411 FvH4_1g22560 FvH4_1g24290 FvH4_1g24290 FvH4_1g24290 FvH4_1g29434 FvH4_2g04031 FvH4_2g04811 FvH4_2g07610 FvH4_2g09412 FvH4_3g15552 FvH4_3g30720 FvH4_4g05810 FvH4_4g09541 FvH4_4g15171 FvH4_6g09145 FvH4_6g49541 FvH4_7g00320 FvH4_7g11552
malus_domestica MD00G1072400.v1.1 MD01G1188100.v1.1 MD07G1132000.v1.1 MD08G1190700.v1.1 MD10G1011200.v1.1 MD14G1164100.v1.1 MD15G1289200.v1.1 MD15G1289300.v1.1 MD17G1245100.v1.1
prunus_persica Prupe.6G228600_v2.0.a1
pyrus_communis pycom01g07070 pycom02g06890 pycom02g06900 pycom02g13930 pycom04g07470 pycom04g11770 pycom04g21930 pycom05g08520 pycom06g04490 pycom06g09560 pycom07g03750 pycom08g08760 pycom08g13660 pycom09g11520 pycom09g14250 pycom09g14770 pycom10g00720 pycom10g01290 pycom10g10480 pycom10g15700 pycom12420g00130 pycom12g05380 pycom12g08750 pycom13g19010 pycom13g29080 pycom14g06210 pycom14g13680 pycom14g19850 pycom15g22070 pycom15g23440 pycom15g24950 pycom15g25280 pycom16g11100 pycom16g17080 pycom16g26310 pycom17g15650 pycom17g15670 pycom17g20370
rosa_chinensis RchiOBHm_Chr1g0373591 RchiOBHm_Chr2g0105551 RchiOBHm_Chr2g0106711 RchiOBHm_Chr2g0106721 RchiOBHm_Chr7g0219611
rosa_laevigata RLG00000013773 RLG00000017436 RLG00000017533
rosa_multiflora Rmu_co8001842.1_g000001 Rmu_co8158450.1_g000001 Rmu_sc0000516.1_g000067 Rmu_sc0000566.1_g000009 Rmu_sc0000965.1_g000025 Rmu_sc0001718.1_g000001 Rmu_sc0001719.1_g000020 Rmu_sc0001822.1_g000025 Rmu_sc0002219.1_g000003 Rmu_sc0002460.1_g000059 Rmu_sc0002757.1_g000001 Rmu_sc0002860.1_g000001 Rmu_sc0004531.1_g000001 Rmu_sc0005558.1_g000003 Rmu_sc0011218.1_g000001 Rmu_sc0011998.1_g000003 Rmu_sc0015560.1_g000002 Rmu_sc0015560.1_g000003
rosa_roxburghii Rroxscaffold_1G00004200 Rroxscaffold_1G00026570 Rroxscaffold_1G00040370 Rroxscaffold_1G00044120 Rroxscaffold_1G00049590 Rroxscaffold_1G00059030 Rroxscaffold_2G00108440 Rroxscaffold_2G00108850 Rroxscaffold_2G00130680 Rroxscaffold_2G00132980 Rroxscaffold_2G00136860 Rroxscaffold_3G00218610 Rroxscaffold_4G00309940 Rroxscaffold_6G00405560
rosa_rugosa Rorug02G0138000 Rorug02G0138100 Rorug02G0138100 Rorug06G0154000
rosa_samantha Rh1AG121500 Rh1CG116300 Rh2AG189000 Rh2AG509600 Rh2BG200200 Rh2CG194100 Rh2DG195300 Rh5AG114400 Rh5DG488800
rosa_wichuraiana Rw0G022020 Rw1G023650 Rw1G026380 Rw1G034750 Rw1G040770 Rw2G014870 Rw2G016560 Rw4G031190 Rw5G026570 Rw6G003020 Rw6G012060 Rw7G014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 23
Acc36I ACCTGC 1 cut(s) 469
AccI GTMKAC 1 cut(s) 587
AcsI RAATTY 2 cut(s) 182, 578
AcuI CTGAAG 1 cut(s) 30
AfaI GTAC 2 cut(s) 148, 459
AfiI CCNNNNNNNGG 1 cut(s) 194
AflIII ACRYGT 2 cut(s) 49, 214
AgsI TTSAA 3 cut(s) 139, 497, 667
AjiI CACGTC 1 cut(s) 50
AjnI CCWGG 1 cut(s) 142
AluBI AGCT 1 cut(s) 493
AluI AGCT 1 cut(s) 493
ApeKI GCWGC 3 cut(s) 449, 464, 656
ApoI RAATTY 2 cut(s) 182, 578
AspS9I GGNCC 1 cut(s) 430
AvaII GGWCC 1 cut(s) 430
BauI CACGAG 1 cut(s) 595
BbvI GCAGC 3 cut(s) 436, 451, 643
BccI CCATC 3 cut(s) 285, 365, 369
BciT130I CCWGG 1 cut(s) 144
BfaI CTAG 1 cut(s) 92
BfuAI ACCTGC 1 cut(s) 469
BisI GCNGC 3 cut(s) 450, 465, 657
BlsI GCNGC 3 cut(s) 451, 466, 658
Bme1390I CCNGG 1 cut(s) 144
Bme18I GGWCC 1 cut(s) 430
BmgBI CACGTC 1 cut(s) 50
BmgT120I GGNCC 1 cut(s) 430
BmrFI CCNGG 1 cut(s) 144
BmsI GCATC 3 cut(s) 355, 364, 505
Bsc4I CCNNNNNNNGG 1 cut(s) 194
Bse1I ACTGG 1 cut(s) 180
BseBI CCWGG 1 cut(s) 144
BseGI GGATG 5 cut(s) 87, 296, 370, 380, 625
BseLI CCNNNNNNNGG 1 cut(s) 194
BseMII CTCAG 1 cut(s) 555
BseNI ACTGG 1 cut(s) 180
BseRI GAGGAG 1 cut(s) 619
BseXI GCAGC 3 cut(s) 436, 451, 643
BslI CCNNNNNNNGG 1 cut(s) 194
BsmI GAATGC 1 cut(s) 172
BspCNI CTCAG 1 cut(s) 556
BspMI ACCTGC 1 cut(s) 469
BspQI GCTCTTC 1 cut(s) 483
BsrI ACTGG 1 cut(s) 180
BssSI CACGAG 1 cut(s) 595
Bst2BI CACGAG 1 cut(s) 595
Bst2UI CCWGG 1 cut(s) 144
Bst4CI ACNGT 1 cut(s) 434
Bst6I CTCTTC 2 cut(s) 84, 483
BstAPI GCANNNNNTGC 1 cut(s) 341
BstC8I GCNNGC 1 cut(s) 510
BstDEI CTNAG 3 cut(s) 528, 564, 643
BstF5I GGATG 5 cut(s) 87, 296, 370, 380, 625
BstMWI GCNNNNNNNGC 1 cut(s) 341
BstNI CCWGG 1 cut(s) 144
BstNSI RCATGY 3 cut(s) 218, 271, 512
BstSCI CCNGG 1 cut(s) 142
BstV1I GCAGC 3 cut(s) 436, 451, 643
BstXI CCANNNNNNTGG 1 cut(s) 281
BtrI CACGTC 1 cut(s) 50
BtsCI GGATG 5 cut(s) 87, 296, 370, 380, 625
BtsI GCAGTG 1 cut(s) 552
BtsIMutI CAGTG 1 cut(s) 552
BveI ACCTGC 1 cut(s) 469
Cac8I GCNNGC 1 cut(s) 510
Cfr13I GGNCC 1 cut(s) 430
CsiI ACCWGGT 1 cut(s) 142
Csp6I GTAC 2 cut(s) 147, 458
CviAII CATG 5 cut(s) 116, 215, 268, 336, 509
CviJI RGCY 3 cut(s) 449, 493, 642
CviKI_1 RGCY 3 cut(s) 449, 493, 642
CviQI GTAC 2 cut(s) 147, 458
DdeI CTNAG 3 cut(s) 528, 564, 643
Eam1104I CTCTTC 2 cut(s) 84, 483
EarI CTCTTC 2 cut(s) 84, 483
Eco47I GGWCC 1 cut(s) 430
Eco57I CTGAAG 1 cut(s) 30
EcoRII CCWGG 1 cut(s) 142
EcoT22I ATGCAT 2 cut(s) 346, 520
FaeI CATG 5 cut(s) 119, 218, 271, 339, 512
FalI AAGNNNNNCTT 3 cut(s) 35, 63, 95
FatI CATG 5 cut(s) 115, 214, 267, 335, 508
FauNDI CATATG 1 cut(s) 346
FblI GTMKAC 1 cut(s) 587
Fnu4HI GCNGC 3 cut(s) 450, 465, 657
FokI GGATG 5 cut(s) 74, 303, 377, 387, 632
Fsp4HI GCNGC 3 cut(s) 450, 465, 657
FspBI CTAG 1 cut(s) 92
GluI GCNGC 3 cut(s) 450, 465, 657
Hin1II CATG 5 cut(s) 119, 218, 271, 339, 512
HincII GTYRAC 1 cut(s) 322
HindII GTYRAC 1 cut(s) 322
HinfI GANTC 5 cut(s) 5, 221, 524, 566, 584
Hpy166II GTNNAC 5 cut(s) 212, 322, 430, 570, 588
Hpy188I TCNGA 2 cut(s) 10, 565
Hpy188III TCNNGA 1 cut(s) 195
Hpy8I GTNNAC 5 cut(s) 212, 322, 430, 570, 588
HpyCH4III ACNGT 1 cut(s) 434
HpyCH4IV ACGT 2 cut(s) 49, 397
HpyCH4V TGCA 5 cut(s) 107, 344, 467, 518, 659
HpyF10VI GCNNNNNNNGC 1 cut(s) 341
HpyF3I CTNAG 3 cut(s) 528, 564, 643
HpySE526I ACGT 2 cut(s) 49, 397
Hsp92II CATG 5 cut(s) 119, 218, 271, 339, 512
LguI GCTCTTC 1 cut(s) 483
LmnI GCTCC 1 cut(s) 276
LpnPI CCDG 6 cut(s) 53, 129, 156, 161, 180, 474
Lsp1109I GCAGC 3 cut(s) 436, 451, 643
LweI GCATC 3 cut(s) 355, 364, 505
MabI ACCWGGT 1 cut(s) 142
MaeI CTAG 1 cut(s) 92
MaeII ACGT 2 cut(s) 49, 397
MboII GAAGA 5 cut(s) 23, 71, 83, 107, 500
MluCI AATT 4 cut(s) 153, 182, 190, 578
MlyI GAGTC 3 cut(s) 230, 575, 593
MnlI CCTC 8 cut(s) 297, 310, 325, 372, 469, 597, 600, 610
Mph1103I ATGCAT 2 cut(s) 346, 520
MseI TTAA 3 cut(s) 231, 240, 483
MslI CAYNNNNRTG 2 cut(s) 363, 513
MspR9I CCNGG 1 cut(s) 144
Mva1269I GAATGC 1 cut(s) 172
MvaI CCWGG 1 cut(s) 144
MwoI GCNNNNNNNGC 1 cut(s) 341
NdeI CATATG 1 cut(s) 346
NlaIII CATG 5 cut(s) 119, 218, 271, 339, 512
NsiI ATGCAT 2 cut(s) 346, 520
NspI RCATGY 3 cut(s) 218, 271, 512
PaeI GCATGC 1 cut(s) 512
PciI ACATGT 1 cut(s) 214
PciSI GCTCTTC 1 cut(s) 483
PctI GAATGC 1 cut(s) 172
PfeI GAWTC 2 cut(s) 5, 524
PkrI GCNGC 3 cut(s) 451, 466, 658
PleI GAGTC 3 cut(s) 229, 574, 592
PpsI GAGTC 3 cut(s) 229, 574, 592
PscI ACATGT 1 cut(s) 214
PsiI TTATAA 1 cut(s) 23
Psp6I CCWGG 1 cut(s) 142
PspGI CCWGG 1 cut(s) 142
PspPI GGNCC 1 cut(s) 430
RsaI GTAC 2 cut(s) 148, 459
RsaNI GTAC 2 cut(s) 147, 458
RseI CAYNNNNRTG 2 cut(s) 363, 513
SapI GCTCTTC 1 cut(s) 483
SaqAI TTAA 3 cut(s) 231, 240, 483
SatI GCNGC 3 cut(s) 450, 465, 657
Sau96I GGNCC 1 cut(s) 430
SchI GAGTC 3 cut(s) 230, 575, 593
ScrFI CCNGG 1 cut(s) 144
SetI ASST 7 cut(s) 52, 145, 321, 400, 463, 495, 534
SexAI ACCWGGT 1 cut(s) 142
SfaNI GCATC 3 cut(s) 355, 364, 505
SinI GGWCC 1 cut(s) 430
SmiMI CAYNNNNRTG 2 cut(s) 363, 513
SphI GCATGC 1 cut(s) 512
Sse9I AATT 4 cut(s) 153, 182, 190, 578
SspMI CTAG 1 cut(s) 92
StyD4I CCNGG 1 cut(s) 142
TaaI ACNGT 1 cut(s) 434
TaiI ACGT 2 cut(s) 52, 400
TaqI TCGA 1 cut(s) 582
TasI AATT 4 cut(s) 153, 182, 190, 578
TfiI GAWTC 2 cut(s) 5, 524
Tru1I TTAA 3 cut(s) 231, 240, 483
Tru9I TTAA 3 cut(s) 231, 240, 483
TscAI CASTG 1 cut(s) 559
TseI GCWGC 3 cut(s) 449, 464, 656
TspDTI ATGAA 2 cut(s) 417, 501
TspRI CASTG 1 cut(s) 559
VpaK11BI GGWCC 1 cut(s) 430
XapI RAATTY 2 cut(s) 182, 578
XceI RCATGY 3 cut(s) 218, 271, 512
XmiI GTMKAC 1 cut(s) 587
XspI CTAG 1 cut(s) 92
Zsp2I ATGCAT 2 cut(s) 346, 520
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.