Rmu_sc0011218.1_g000001
MYB Family

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011218.1
Physical Location & Seq
Forward (+)
3824 .. 4189
366 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011218.1_g000001.1.cds

Sequence Viewer

Length: 366 bp
atgatggaggagcagagcaacaatgaagatggtataggccttgtgaatgacacaagccccatgtcaatgagcaaagatagcgcgggacaatctcaggtcagtcagaaaaagaggaaaagaaattatgaagataaaattatgcttgcattggataaattgtttgaagaatctggaaaaagaatgcaagcagtgactgatgctaaggaacttaagaaaatgggactttctgttctagaccaaattgaggcattgaaaatcattttagataagccccagaatatctctgtattcatgtccttagatgatgaagtgagaaaagtgtatgtcaagaacttgcttgcgggcactgctagaggatctacctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

121

Amino Acids

13.53

Weight (kDa)

6.32

Isoelectric Point (pI)

55.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000261)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18411 FvH4_1g22560 FvH4_1g24290 FvH4_1g24290 FvH4_1g24290 FvH4_1g29434 FvH4_2g04031 FvH4_2g04811 FvH4_2g07610 FvH4_2g09412 FvH4_3g15552 FvH4_3g30720 FvH4_4g05810 FvH4_4g09541 FvH4_4g15171 FvH4_6g09145 FvH4_6g49541 FvH4_7g00320 FvH4_7g11552
malus_domestica MD00G1072400.v1.1 MD01G1188100.v1.1 MD07G1132000.v1.1 MD08G1190700.v1.1 MD10G1011200.v1.1 MD14G1164100.v1.1 MD15G1289200.v1.1 MD15G1289300.v1.1 MD17G1245100.v1.1
prunus_persica Prupe.6G228600_v2.0.a1
pyrus_communis pycom01g07070 pycom02g06890 pycom02g06900 pycom02g13930 pycom04g07470 pycom04g11770 pycom04g21930 pycom05g08520 pycom06g04490 pycom06g09560 pycom07g03750 pycom08g08760 pycom08g13660 pycom09g11520 pycom09g14250 pycom09g14770 pycom10g00720 pycom10g01290 pycom10g10480 pycom10g15700 pycom12420g00130 pycom12g05380 pycom12g08750 pycom13g19010 pycom13g29080 pycom14g06210 pycom14g13680 pycom14g19850 pycom15g22070 pycom15g23440 pycom15g24950 pycom15g25280 pycom16g11100 pycom16g17080 pycom16g26310 pycom17g15650 pycom17g15670 pycom17g20370
rosa_chinensis RchiOBHm_Chr1g0373591 RchiOBHm_Chr2g0105551 RchiOBHm_Chr2g0106711 RchiOBHm_Chr2g0106721 RchiOBHm_Chr7g0219611
rosa_laevigata RLG00000013773 RLG00000017436 RLG00000017533
rosa_multiflora Rmu_co8001842.1_g000001 Rmu_co8158450.1_g000001 Rmu_sc0000516.1_g000067 Rmu_sc0000566.1_g000009 Rmu_sc0000965.1_g000025 Rmu_sc0001718.1_g000001 Rmu_sc0001719.1_g000020 Rmu_sc0001822.1_g000025 Rmu_sc0002219.1_g000003 Rmu_sc0002460.1_g000059 Rmu_sc0002757.1_g000001 Rmu_sc0002860.1_g000001 Rmu_sc0004531.1_g000001 Rmu_sc0005558.1_g000003 Rmu_sc0011218.1_g000001 Rmu_sc0011998.1_g000003 Rmu_sc0015560.1_g000002 Rmu_sc0015560.1_g000003
rosa_roxburghii Rroxscaffold_1G00004200 Rroxscaffold_1G00026570 Rroxscaffold_1G00040370 Rroxscaffold_1G00044120 Rroxscaffold_1G00049590 Rroxscaffold_1G00059030 Rroxscaffold_2G00108440 Rroxscaffold_2G00108850 Rroxscaffold_2G00130680 Rroxscaffold_2G00132980 Rroxscaffold_2G00136860 Rroxscaffold_3G00218610 Rroxscaffold_4G00309940 Rroxscaffold_6G00405560
rosa_rugosa Rorug02G0138000 Rorug02G0138100 Rorug02G0138100 Rorug06G0154000
rosa_samantha Rh1AG121500 Rh1CG116300 Rh2AG189000 Rh2AG509600 Rh2BG200200 Rh2CG194100 Rh2DG195300 Rh5AG114400 Rh5DG488800
rosa_wichuraiana Rw0G022020 Rw1G023650 Rw1G026380 Rw1G034750 Rw1G040770 Rw2G014870 Rw2G016560 Rw4G031190 Rw5G026570 Rw6G003020 Rw6G012060 Rw7G014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 83
AciI CCGC 2 cut(s) 83, 341
AclWI GGATC 1 cut(s) 364
AfiI CCNNNNNNNGG 1 cut(s) 244
AflII CTTAAG 1 cut(s) 209
AgsI TTSAA 2 cut(s) 164, 253
AloI GAACNNNNNNTCC 2 cut(s) 213, 245
AlwI GGATC 1 cut(s) 364
AlwNI CAGNNNCTG 1 cut(s) 194
AoxI GGCC 1 cut(s) 37
AspLEI GCGC 1 cut(s) 83
BaeGI GKGCMC 1 cut(s) 347
BccI CCATC 1 cut(s) 23
BfaI CTAG 3 cut(s) 233, 351, 364
BfrI CTTAAG 1 cut(s) 209
BmsI GCATC 1 cut(s) 187
Bpu10I CCTNAGC 1 cut(s) 201
Bsc4I CCNNNNNNNGG 1 cut(s) 244
BseLI CCNNNNNNNGG 1 cut(s) 244
BseMII CTCAG 1 cut(s) 107
BseRI GAGGAG 1 cut(s) 23
BseSI GKGCMC 1 cut(s) 347
Bsh1236I CGCG 1 cut(s) 83
BshFI GGCC 1 cut(s) 39
BslFI GGGAC 2 cut(s) 99, 234
BslI CCNNNNNNNGG 1 cut(s) 244
BsmFI GGGAC 2 cut(s) 99, 234
BsmI GAATGC 1 cut(s) 186
BsnI GGCC 1 cut(s) 39
Bsp1286I GDGCHC 1 cut(s) 347
Bsp143I GATC 1 cut(s) 356
BspACI CCGC 2 cut(s) 83, 341
BspANI GGCC 1 cut(s) 39
BspCNI CTCAG 1 cut(s) 106
BspFNI CGCG 1 cut(s) 83
BspPI GGATC 1 cut(s) 364
BspTI CTTAAG 1 cut(s) 209
BssMI GATC 1 cut(s) 356
BstAFI CTTAAG 1 cut(s) 209
BstC8I GCNNGC 4 cut(s) 144, 186, 339, 343
BstDEI CTNAG 3 cut(s) 93, 201, 298
BstFNI CGCG 1 cut(s) 83
BstHHI GCGC 1 cut(s) 83
BstKTI GATC 1 cut(s) 359
BstMBI GATC 1 cut(s) 356
BstMWI GCNNNNNNNGC 2 cut(s) 78, 347
BstSLI GKGCMC 1 cut(s) 347
BstUI CGCG 1 cut(s) 83
BstX2I RGATCY 1 cut(s) 356
BstYI RGATCY 1 cut(s) 356
BsuRI GGCC 1 cut(s) 39
BtsI GCAGTG 2 cut(s) 195, 345
BtsIMutI CAGTG 2 cut(s) 195, 345
Cac8I GCNNGC 4 cut(s) 144, 186, 339, 343
CaiI CAGNNNCTG 1 cut(s) 194
CfoI GCGC 1 cut(s) 83
CviAII CATG 2 cut(s) 61, 292
CviJI RGCY 3 cut(s) 39, 57, 271
CviKI_1 RGCY 3 cut(s) 39, 57, 271
DdeI CTNAG 3 cut(s) 93, 201, 298
DpnI GATC 1 cut(s) 358
DpnII GATC 1 cut(s) 356
Eco147I AGGCCT 1 cut(s) 39
FaeI CATG 2 cut(s) 64, 295
FaiI YATR 6 cut(s) 35, 62, 126, 140, 293, 324
FaqI GGGAC 2 cut(s) 99, 234
FatI CATG 2 cut(s) 60, 291
FauI CCCGC 2 cut(s) 76, 334
FspBI CTAG 3 cut(s) 233, 351, 364
GlaI GCGC 1 cut(s) 82
HaeIII GGCC 1 cut(s) 39
HhaI GCGC 1 cut(s) 83
Hin1II CATG 2 cut(s) 64, 295
Hin6I GCGC 1 cut(s) 81
HinP1I GCGC 1 cut(s) 81
HinfI GANTC 1 cut(s) 167
Hpy188I TCNGA 1 cut(s) 105
Hpy188III TCNNGA 3 cut(s) 171, 233, 328
HpyCH4V TGCA 2 cut(s) 146, 184
HpyF10VI GCNNNNNNNGC 2 cut(s) 78, 347
HpyF3I CTNAG 3 cut(s) 93, 201, 298
Hsp92II CATG 2 cut(s) 64, 295
HspAI GCGC 1 cut(s) 81
Kzo9I GATC 1 cut(s) 356
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 3 cut(s) 80, 156, 287
LweI GCATC 1 cut(s) 187
MaeI CTAG 3 cut(s) 233, 351, 364
MaeIII GTNAC 1 cut(s) 190
MalI GATC 1 cut(s) 358
MboI GATC 1 cut(s) 356
MboII GAAGA 3 cut(s) 38, 140, 176
MflI RGATCY 1 cut(s) 356
MhlI GDGCHC 1 cut(s) 347
MluCI AATT 4 cut(s) 121, 135, 155, 240
MnlI CCTC 3 cut(s) 105, 238, 347
MseI TTAA 1 cut(s) 210
MslI CAYNNNNRTG 1 cut(s) 65
MspCI CTTAAG 1 cut(s) 209
Mva1269I GAATGC 1 cut(s) 186
MvnI CGCG 1 cut(s) 83
MwoI GCNNNNNNNGC 2 cut(s) 78, 347
NdeII GATC 1 cut(s) 356
NlaIII CATG 2 cut(s) 64, 295
NmuCI GTSAC 1 cut(s) 190
PceI AGGCCT 1 cut(s) 39
PctI GAATGC 1 cut(s) 186
PfeI GAWTC 1 cut(s) 167
PstNI CAGNNNCTG 1 cut(s) 194
PsuI RGATCY 1 cut(s) 356
RseI CAYNNNNRTG 1 cut(s) 65
SaqAI TTAA 1 cut(s) 210
Sau3AI GATC 1 cut(s) 356
SduI GDGCHC 1 cut(s) 347
SetI ASST 2 cut(s) 99, 365
SfaNI GCATC 1 cut(s) 187
SmiMI CAYNNNNRTG 1 cut(s) 65
SmlI CTYRAG 1 cut(s) 209
SmoI CTYRAG 1 cut(s) 209
Sse9I AATT 4 cut(s) 121, 135, 155, 240
SseBI AGGCCT 1 cut(s) 39
SsiI CCGC 2 cut(s) 83, 341
SspMI CTAG 3 cut(s) 233, 351, 364
StuI AGGCCT 1 cut(s) 39
TasI AATT 4 cut(s) 121, 135, 155, 240
TfiI GAWTC 1 cut(s) 167
Tru1I TTAA 1 cut(s) 210
Tru9I TTAA 1 cut(s) 210
TscAI CASTG 2 cut(s) 195, 352
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
TspDTI ATGAA 4 cut(s) 39, 141, 280, 321
TspRI CASTG 2 cut(s) 195, 352
Vha464I CTTAAG 1 cut(s) 209
XbaI TCTAGA 1 cut(s) 232
XspI CTAG 3 cut(s) 233, 351, 364
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.