Rh1CG116300
MYB Family

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
25164998 .. 25168284
3287 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG116300.1

Sequence Viewer

Length: 456 bp
ATGCTGTCTTTTAGAGTTATCATGGCTTCTAGTGGTGTTTCTTTTGGGATGGATTCTGAAGATAATAGTCTTATAAGTGATAGAAAAAAGAGAGAAAGACGTGTATGGACAGATGAGCAGGAAGATACTCTTCTAAACATCCTAGAAGAACTAGTTGCAAATGGTCATGCTCGTAAAAATGGCACATTCAAACCTGGTACATCAATTATGATTGAGAATGCTTTACTAGATAAATTTCCCAATTCTGGACTAAAGTATAGTCCACATGTTGAGTCAAAGATTAAGGACTTTAAGAAAAAATATGTTGTGGTATATGACATGCTCCAAAAAAGTGGATTTGGATGGAATGATGTGAGGAAGTGCGTTGAGGTTGACAATGATGAGGCATGGTATGCATATGTCAAGGTAAATTTTACTAGTTTGATGAAAAGTGGCAGAAACTGTTTTAAACTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

151

Amino Acids

17.37

Weight (kDa)

8.8

Isoelectric Point (pI)

32.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-bind_3 PF12776 36 - 133 2.9e-12 Myb/SANT-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000261)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18411 FvH4_1g22560 FvH4_1g24290 FvH4_1g24290 FvH4_1g24290 FvH4_1g29434 FvH4_2g04031 FvH4_2g04811 FvH4_2g07610 FvH4_2g09412 FvH4_3g15552 FvH4_3g30720 FvH4_4g05810 FvH4_4g09541 FvH4_4g15171 FvH4_6g09145 FvH4_6g49541 FvH4_7g00320 FvH4_7g11552
malus_domestica MD00G1072400.v1.1 MD01G1188100.v1.1 MD07G1132000.v1.1 MD08G1190700.v1.1 MD10G1011200.v1.1 MD14G1164100.v1.1 MD15G1289200.v1.1 MD15G1289300.v1.1 MD17G1245100.v1.1
prunus_persica Prupe.6G228600_v2.0.a1
pyrus_communis pycom01g07070 pycom02g06890 pycom02g06900 pycom02g13930 pycom04g07470 pycom04g11770 pycom04g21930 pycom05g08520 pycom06g04490 pycom06g09560 pycom07g03750 pycom08g08760 pycom08g13660 pycom09g11520 pycom09g14250 pycom09g14770 pycom10g00720 pycom10g01290 pycom10g10480 pycom10g15700 pycom12420g00130 pycom12g05380 pycom12g08750 pycom13g19010 pycom13g29080 pycom14g06210 pycom14g13680 pycom14g19850 pycom15g22070 pycom15g23440 pycom15g24950 pycom15g25280 pycom16g11100 pycom16g17080 pycom16g26310 pycom17g15650 pycom17g15670 pycom17g20370
rosa_chinensis RchiOBHm_Chr1g0373591 RchiOBHm_Chr2g0105551 RchiOBHm_Chr2g0106711 RchiOBHm_Chr2g0106721 RchiOBHm_Chr7g0219611
rosa_laevigata RLG00000013773 RLG00000017436 RLG00000017533
rosa_multiflora Rmu_co8001842.1_g000001 Rmu_co8158450.1_g000001 Rmu_sc0000516.1_g000067 Rmu_sc0000566.1_g000009 Rmu_sc0000965.1_g000025 Rmu_sc0001718.1_g000001 Rmu_sc0001719.1_g000020 Rmu_sc0001822.1_g000025 Rmu_sc0002219.1_g000003 Rmu_sc0002460.1_g000059 Rmu_sc0002757.1_g000001 Rmu_sc0002860.1_g000001 Rmu_sc0004531.1_g000001 Rmu_sc0005558.1_g000003 Rmu_sc0011218.1_g000001 Rmu_sc0011998.1_g000003 Rmu_sc0015560.1_g000002 Rmu_sc0015560.1_g000003
rosa_roxburghii Rroxscaffold_1G00004200 Rroxscaffold_1G00026570 Rroxscaffold_1G00040370 Rroxscaffold_1G00044120 Rroxscaffold_1G00049590 Rroxscaffold_1G00059030 Rroxscaffold_2G00108440 Rroxscaffold_2G00108850 Rroxscaffold_2G00130680 Rroxscaffold_2G00132980 Rroxscaffold_2G00136860 Rroxscaffold_3G00218610 Rroxscaffold_4G00309940 Rroxscaffold_6G00405560
rosa_rugosa Rorug02G0138000 Rorug02G0138100 Rorug02G0138100 Rorug06G0154000
rosa_samantha Rh1AG121500 Rh1CG116300 Rh2AG189000 Rh2AG509600 Rh2BG200200 Rh2CG194100 Rh2DG195300 Rh5AG114400 Rh5DG488800
rosa_wichuraiana Rw0G022020 Rw1G023650 Rw1G026380 Rw1G034750 Rw1G040770 Rw2G014870 Rw2G016560 Rw4G031190 Rw5G026570 Rw6G003020 Rw6G012060 Rw7G014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 74
AcsI RAATTY 2 cut(s) 233, 409
AcuI CTGAAG 1 cut(s) 78
AfaI GTAC 1 cut(s) 199
AfiI CCNNNNNNNGG 1 cut(s) 245
AflIII ACRYGT 2 cut(s) 100, 265
AgsI TTSAA 1 cut(s) 190
AhlI ACTAGT 2 cut(s) 151, 416
AjiI CACGTC 1 cut(s) 101
AjnI CCWGG 1 cut(s) 193
AlwNI CAGNNNCTG 1 cut(s) 441
ApoI RAATTY 2 cut(s) 233, 409
BccI CCATC 2 cut(s) 43, 336
BciT130I CCWGG 1 cut(s) 195
BcuI ACTAGT 2 cut(s) 151, 416
BfaI CTAG 5 cut(s) 30, 143, 152, 227, 417
Bme1390I CCNGG 1 cut(s) 195
BmgBI CACGTC 1 cut(s) 101
BmrFI CCNGG 1 cut(s) 195
Bsc4I CCNNNNNNNGG 1 cut(s) 245
BseBI CCWGG 1 cut(s) 195
BseGI GGATG 3 cut(s) 54, 138, 347
BseLI CCNNNNNNNGG 1 cut(s) 245
BslI CCNNNNNNNGG 1 cut(s) 245
BsmI GAATGC 1 cut(s) 223
Bst2UI CCWGG 1 cut(s) 195
Bst4CI ACNGT 1 cut(s) 443
Bst6I CTCTTC 1 cut(s) 135
BstAPI GCANNNNNTGC 1 cut(s) 392
BstF5I GGATG 3 cut(s) 54, 138, 347
BstMWI GCNNNNNNNGC 1 cut(s) 392
BstNI CCWGG 1 cut(s) 195
BstNSI RCATGY 2 cut(s) 269, 322
BstSCI CCNGG 1 cut(s) 193
BstXI CCANNNNNNTGG 1 cut(s) 332
BtrI CACGTC 1 cut(s) 101
BtsCI GGATG 3 cut(s) 54, 138, 347
CaiI CAGNNNCTG 1 cut(s) 441
CsiI ACCWGGT 1 cut(s) 193
Csp6I GTAC 1 cut(s) 198
CviAII CATG 5 cut(s) 22, 167, 266, 319, 387
CviJI RGCY 1 cut(s) 26
CviKI_1 RGCY 1 cut(s) 26
CviQI GTAC 1 cut(s) 198
DraI TTTAAA 1 cut(s) 448
Eam1104I CTCTTC 1 cut(s) 135
EarI CTCTTC 1 cut(s) 135
Eco57I CTGAAG 1 cut(s) 78
EcoRII CCWGG 1 cut(s) 193
EcoT22I ATGCAT 1 cut(s) 397
FaeI CATG 5 cut(s) 25, 170, 269, 322, 390
FalI AAGNNNNNCTT 2 cut(s) 114, 146
FatI CATG 5 cut(s) 21, 166, 265, 318, 386
FauNDI CATATG 1 cut(s) 397
FokI GGATG 3 cut(s) 61, 125, 354
FspBI CTAG 5 cut(s) 30, 143, 152, 227, 417
Hin1II CATG 5 cut(s) 25, 170, 269, 322, 390
HincII GTYRAC 1 cut(s) 373
HindII GTYRAC 1 cut(s) 373
HinfI GANTC 2 cut(s) 53, 272
Hpy166II GTNNAC 2 cut(s) 263, 373
Hpy188I TCNGA 2 cut(s) 58, 455
Hpy188III TCNNGA 1 cut(s) 246
Hpy8I GTNNAC 2 cut(s) 263, 373
HpyCH4III ACNGT 1 cut(s) 443
HpyCH4IV ACGT 1 cut(s) 100
HpyCH4V TGCA 2 cut(s) 158, 395
HpyF10VI GCNNNNNNNGC 1 cut(s) 392
HpySE526I ACGT 1 cut(s) 100
Hsp92II CATG 5 cut(s) 25, 170, 269, 322, 390
LmnI GCTCC 1 cut(s) 327
LpnPI CCDG 4 cut(s) 104, 180, 207, 231
MabI ACCWGGT 1 cut(s) 193
MaeI CTAG 5 cut(s) 30, 143, 152, 227, 417
MaeII ACGT 1 cut(s) 100
MboII GAAGA 4 cut(s) 71, 122, 134, 158
MluCI AATT 4 cut(s) 204, 233, 241, 409
MlyI GAGTC 1 cut(s) 281
MnlI CCTC 3 cut(s) 348, 361, 376
Mph1103I ATGCAT 1 cut(s) 397
MseI TTAA 3 cut(s) 282, 291, 447
MspR9I CCNGG 1 cut(s) 195
Mva1269I GAATGC 1 cut(s) 223
MvaI CCWGG 1 cut(s) 195
MwoI GCNNNNNNNGC 1 cut(s) 392
NdeI CATATG 1 cut(s) 397
NlaIII CATG 5 cut(s) 25, 170, 269, 322, 390
NsiI ATGCAT 1 cut(s) 397
NspI RCATGY 2 cut(s) 269, 322
PciI ACATGT 1 cut(s) 265
PctI GAATGC 1 cut(s) 223
PfeI GAWTC 1 cut(s) 53
PleI GAGTC 1 cut(s) 280
PpsI GAGTC 1 cut(s) 280
PscI ACATGT 1 cut(s) 265
PsiI TTATAA 1 cut(s) 74
Psp6I CCWGG 1 cut(s) 193
PspGI CCWGG 1 cut(s) 193
PstNI CAGNNNCTG 1 cut(s) 441
RsaI GTAC 1 cut(s) 199
RsaNI GTAC 1 cut(s) 198
SaqAI TTAA 3 cut(s) 282, 291, 447
SchI GAGTC 1 cut(s) 281
ScrFI CCNGG 1 cut(s) 195
SetI ASST 4 cut(s) 103, 196, 372, 408
SexAI ACCWGGT 1 cut(s) 193
SpeI ACTAGT 2 cut(s) 151, 416
Sse9I AATT 4 cut(s) 204, 233, 241, 409
SspMI CTAG 5 cut(s) 30, 143, 152, 227, 417
StyD4I CCNGG 1 cut(s) 193
TaaI ACNGT 1 cut(s) 443
TaiI ACGT 1 cut(s) 103
TasI AATT 4 cut(s) 204, 233, 241, 409
TfiI GAWTC 1 cut(s) 53
Tru1I TTAA 3 cut(s) 282, 291, 447
Tru9I TTAA 3 cut(s) 282, 291, 447
TspDTI ATGAA 1 cut(s) 440
XapI RAATTY 2 cut(s) 233, 409
XceI RCATGY 2 cut(s) 269, 322
XspI CTAG 5 cut(s) 30, 143, 152, 227, 417
Zsp2I ATGCAT 1 cut(s) 397
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.