Rmu_sc0002757.1_g000001
MYB Family

nuclease HARBI1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002757.1
OG0000261
Physical Location & Seq
Forward (+)
1 .. 323
323 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002757.1_g000001.1.cds

Sequence Viewer

Length: 323 bp
agggatggagaaacaagaagtatccattatttgatagactagctaccatctttgggagtgaccgtgctactggaaatggggctgaggtccctgttgatatgttggaggagcaaagcaacaatgaagatgatataggcattgagaatgacacaagccccatgtcaatgaggcaagatagcacaggacaatctcaggtcagtcagaaaaagaggaaaagaaatgatgaagataaaattatgcttgcattggataaattgtttgaagaatccggaaaaagaatgcaagcagtgactgatgccatagtgaaaggtaatgaagattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

106

Amino Acids

11.94

Weight (kDa)

4.79

Isoelectric Point (pI)

55.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000261)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18411 FvH4_1g22560 FvH4_1g24290 FvH4_1g24290 FvH4_1g24290 FvH4_1g29434 FvH4_2g04031 FvH4_2g04811 FvH4_2g07610 FvH4_2g09412 FvH4_3g15552 FvH4_3g30720 FvH4_4g05810 FvH4_4g09541 FvH4_4g15171 FvH4_6g09145 FvH4_6g49541 FvH4_7g00320 FvH4_7g11552
malus_domestica MD00G1072400.v1.1 MD01G1188100.v1.1 MD07G1132000.v1.1 MD08G1190700.v1.1 MD10G1011200.v1.1 MD14G1164100.v1.1 MD15G1289200.v1.1 MD15G1289300.v1.1 MD17G1245100.v1.1
prunus_persica Prupe.6G228600_v2.0.a1
pyrus_communis pycom01g07070 pycom02g06890 pycom02g06900 pycom02g13930 pycom04g07470 pycom04g11770 pycom04g21930 pycom05g08520 pycom06g04490 pycom06g09560 pycom07g03750 pycom08g08760 pycom08g13660 pycom09g11520 pycom09g14250 pycom09g14770 pycom10g00720 pycom10g01290 pycom10g10480 pycom10g15700 pycom12420g00130 pycom12g05380 pycom12g08750 pycom13g19010 pycom13g29080 pycom14g06210 pycom14g13680 pycom14g19850 pycom15g22070 pycom15g23440 pycom15g24950 pycom15g25280 pycom16g11100 pycom16g17080 pycom16g26310 pycom17g15650 pycom17g15670 pycom17g20370
rosa_chinensis RchiOBHm_Chr1g0373591 RchiOBHm_Chr2g0105551 RchiOBHm_Chr2g0106711 RchiOBHm_Chr2g0106721 RchiOBHm_Chr7g0219611
rosa_laevigata RLG00000013773 RLG00000017436 RLG00000017533
rosa_multiflora Rmu_co8001842.1_g000001 Rmu_co8158450.1_g000001 Rmu_sc0000516.1_g000067 Rmu_sc0000566.1_g000009 Rmu_sc0000965.1_g000025 Rmu_sc0001718.1_g000001 Rmu_sc0001719.1_g000020 Rmu_sc0001822.1_g000025 Rmu_sc0002219.1_g000003 Rmu_sc0002460.1_g000059 Rmu_sc0002757.1_g000001 Rmu_sc0002860.1_g000001 Rmu_sc0004531.1_g000001 Rmu_sc0005558.1_g000003 Rmu_sc0011218.1_g000001 Rmu_sc0011998.1_g000003 Rmu_sc0015560.1_g000002 Rmu_sc0015560.1_g000003
rosa_roxburghii Rroxscaffold_1G00004200 Rroxscaffold_1G00026570 Rroxscaffold_1G00040370 Rroxscaffold_1G00044120 Rroxscaffold_1G00049590 Rroxscaffold_1G00059030 Rroxscaffold_2G00108440 Rroxscaffold_2G00108850 Rroxscaffold_2G00130680 Rroxscaffold_2G00132980 Rroxscaffold_2G00136860 Rroxscaffold_3G00218610 Rroxscaffold_4G00309940 Rroxscaffold_6G00405560
rosa_rugosa Rorug02G0138000 Rorug02G0138100 Rorug02G0138100 Rorug06G0154000
rosa_samantha Rh1AG121500 Rh1CG116300 Rh2AG189000 Rh2AG509600 Rh2BG200200 Rh2CG194100 Rh2DG195300 Rh5AG114400 Rh5DG488800
rosa_wichuraiana Rw0G022020 Rw1G023650 Rw1G026380 Rw1G034750 Rw1G040770 Rw2G014870 Rw2G016560 Rw4G031190 Rw5G026570 Rw6G003020 Rw6G012060 Rw7G014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 268
AfiI CCNNNNNNNGG 1 cut(s) 53
AgsI TTSAA 1 cut(s) 262
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
AlwNI CAGNNNCTG 1 cut(s) 292
Aor13HI TCCGGA 1 cut(s) 268
AspS9I GGNCC 1 cut(s) 87
AvaII GGWCC 1 cut(s) 87
BbvCI CCTCAGC 1 cut(s) 83
BccI CCATC 1 cut(s) 55
BciVI GTATCC 1 cut(s) 32
BfaI CTAG 1 cut(s) 40
BfuI GTATCC 1 cut(s) 32
Bme18I GGWCC 1 cut(s) 87
BmgT120I GGNCC 1 cut(s) 87
BmiI GGNNCC 1 cut(s) 89
BmsI GCATC 1 cut(s) 285
Bpu10I CCTNAGC 1 cut(s) 83
BsaWI WCCGGW 1 cut(s) 268
BsaXI ACNNNNNCTCC 2 cut(s) 48, 78
Bsc4I CCNNNNNNNGG 1 cut(s) 53
Bse1I ACTGG 1 cut(s) 75
BseAI TCCGGA 1 cut(s) 268
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 53
BseMII CTCAG 2 cut(s) 74, 205
BseNI ACTGG 1 cut(s) 75
BseRI GAGGAG 1 cut(s) 121
BsiSI CCGG 1 cut(s) 269
BslFI GGGAC 1 cut(s) 73
BslI CCNNNNNNNGG 1 cut(s) 53
BsmFI GGGAC 1 cut(s) 73
BsmI GAATGC 1 cut(s) 284
Bsp13I TCCGGA 1 cut(s) 268
BspCNI CTCAG 2 cut(s) 75, 204
BspEI TCCGGA 1 cut(s) 268
BspLI GGNNCC 1 cut(s) 89
BsrI ACTGG 1 cut(s) 75
Bst4CI ACNGT 1 cut(s) 64
BstC8I GCNNGC 2 cut(s) 242, 284
BstDEI CTNAG 2 cut(s) 83, 191
BstF5I GGATG 1 cut(s) 10
BsuI GTATCC 1 cut(s) 32
BtsCI GGATG 1 cut(s) 10
BtsI GCAGTG 1 cut(s) 293
BtsIMutI CAGTG 1 cut(s) 293
Cac8I GCNNGC 2 cut(s) 242, 284
CaiI CAGNNNCTG 1 cut(s) 292
Cfr13I GGNCC 1 cut(s) 87
CviAII CATG 1 cut(s) 159
CviJI RGCY 3 cut(s) 43, 82, 155
CviKI_1 RGCY 3 cut(s) 43, 82, 155
DdeI CTNAG 2 cut(s) 83, 191
Eco47I GGWCC 1 cut(s) 87
EcoO109I RGGNCCY 1 cut(s) 87
FaeI CATG 1 cut(s) 162
FaiI YATR 5 cut(s) 100, 133, 160, 238, 301
FaqI GGGAC 1 cut(s) 73
FatI CATG 1 cut(s) 158
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 40
HapII CCGG 1 cut(s) 269
Hin1II CATG 1 cut(s) 162
HinfI GANTC 1 cut(s) 265
HpaII CCGG 1 cut(s) 269
Hpy188I TCNGA 1 cut(s) 203
Hpy188III TCNNGA 1 cut(s) 269
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 2 cut(s) 244, 282
HpyF3I CTNAG 2 cut(s) 83, 191
Hsp92II CATG 1 cut(s) 162
Kpn2I TCCGGA 1 cut(s) 268
LmnI GCTCC 1 cut(s) 108
LpnPI CCDG 5 cut(s) 56, 104, 167, 178, 282
LweI GCATC 1 cut(s) 285
MaeI CTAG 1 cut(s) 40
MaeIII GTNAC 2 cut(s) 58, 288
MboII GAAGA 3 cut(s) 136, 238, 274
MluCI AATT 2 cut(s) 233, 253
MmeI TCCRAC 1 cut(s) 83
MnlI CCTC 4 cut(s) 78, 99, 161, 203
MroI TCCGGA 1 cut(s) 268
MslI CAYNNNNRTG 1 cut(s) 163
MspI CCGG 1 cut(s) 269
Mva1269I GAATGC 1 cut(s) 284
NlaIII CATG 1 cut(s) 162
NlaIV GGNNCC 1 cut(s) 89
NmuCI GTSAC 2 cut(s) 58, 288
PctI GAATGC 1 cut(s) 284
PfeI GAWTC 1 cut(s) 265
PpuMI RGGWCCY 1 cut(s) 87
Psp5II RGGWCCY 1 cut(s) 87
PspN4I GGNNCC 1 cut(s) 89
PspPI GGNCC 1 cut(s) 87
PspPPI RGGWCCY 1 cut(s) 87
PstNI CAGNNNCTG 1 cut(s) 292
RseI CAYNNNNRTG 1 cut(s) 163
Sau96I GGNCC 1 cut(s) 87
SetI ASST 4 cut(s) 45, 89, 197, 312
SfaNI GCATC 1 cut(s) 285
SinI GGWCC 1 cut(s) 87
SmiMI CAYNNNNRTG 1 cut(s) 163
Sse9I AATT 2 cut(s) 233, 253
SspMI CTAG 1 cut(s) 40
TaaI ACNGT 1 cut(s) 64
TasI AATT 2 cut(s) 233, 253
TfiI GAWTC 1 cut(s) 265
TscAI CASTG 1 cut(s) 293
TseFI GTSAC 2 cut(s) 58, 288
Tsp45I GTSAC 2 cut(s) 58, 288
TspDTI ATGAA 2 cut(s) 137, 239
TspRI CASTG 1 cut(s) 293
VpaK11BI GGWCC 1 cut(s) 87
XspI CTAG 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.