Rmu_sc0004531.1_g000001
MYB Family

isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004531.1
OG0000261
Physical Location & Seq
Reverse (-)
725 .. 1676
952 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004531.1_g000001.1.cds

Sequence Viewer

Length: 801 bp
atggaaagtggtgatgaaaatacagagcaagggaagtcaaggcgtgtatggactagctttgaagaagaatctttgttgaatgttcttgacggaattattgctagaggacaacgctacgacactggaagtttcaaatctgttactttactgaaaatcgagaatgctttaaatcttttatgtcccaattccaatctgaaggcaagtccacatattgagtcaaagttgaagaaattgaagaaagattatagcataatctatgacatgatgaacaagagtggatttgcatggaatgatatcaaaaagtgcattgaagttgatagtaatgaagtatgggatacatatatatttgcagctaccatctttgggagtgaccatgcgactagaactggagctgaggtccatgctaatatgatggaggagcagagtaaaaatgaagatggcattgaagttgagaatgacacaagccccatgtcaatgagcacgagacaatctcaggttagtcagaaaaaaaggaaaagaaatgatgaagataaaataatgcttgcattggataaattgtttgaagaatttggaaaaagaatgcaagcagtgactgatgctatagtgaaaggtaatgaagatcgatttgatgttgctaaggaacttaagaaaatgggactttctgttctagaccaaattaaggcattgaaaattattttggataagccccaaaatatctctgtgttcatgtccttagatgatgaagtgcgaaaagtgtatgtggataacttgcttgtgggcactgatagaggatctacataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

266

Amino Acids

30.18

Weight (kDa)

5.35

Isoelectric Point (pI)

42.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000261)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18411 FvH4_1g22560 FvH4_1g24290 FvH4_1g24290 FvH4_1g24290 FvH4_1g29434 FvH4_2g04031 FvH4_2g04811 FvH4_2g07610 FvH4_2g09412 FvH4_3g15552 FvH4_3g30720 FvH4_4g05810 FvH4_4g09541 FvH4_4g15171 FvH4_6g09145 FvH4_6g49541 FvH4_7g00320 FvH4_7g11552
malus_domestica MD00G1072400.v1.1 MD01G1188100.v1.1 MD07G1132000.v1.1 MD08G1190700.v1.1 MD10G1011200.v1.1 MD14G1164100.v1.1 MD15G1289200.v1.1 MD15G1289300.v1.1 MD17G1245100.v1.1
prunus_persica Prupe.6G228600_v2.0.a1
pyrus_communis pycom01g07070 pycom02g06890 pycom02g06900 pycom02g13930 pycom04g07470 pycom04g11770 pycom04g21930 pycom05g08520 pycom06g04490 pycom06g09560 pycom07g03750 pycom08g08760 pycom08g13660 pycom09g11520 pycom09g14250 pycom09g14770 pycom10g00720 pycom10g01290 pycom10g10480 pycom10g15700 pycom12420g00130 pycom12g05380 pycom12g08750 pycom13g19010 pycom13g29080 pycom14g06210 pycom14g13680 pycom14g19850 pycom15g22070 pycom15g23440 pycom15g24950 pycom15g25280 pycom16g11100 pycom16g17080 pycom16g26310 pycom17g15650 pycom17g15670 pycom17g20370
rosa_chinensis RchiOBHm_Chr1g0373591 RchiOBHm_Chr2g0105551 RchiOBHm_Chr2g0106711 RchiOBHm_Chr2g0106721 RchiOBHm_Chr7g0219611
rosa_laevigata RLG00000013773 RLG00000017436 RLG00000017533
rosa_multiflora Rmu_co8001842.1_g000001 Rmu_co8158450.1_g000001 Rmu_sc0000516.1_g000067 Rmu_sc0000566.1_g000009 Rmu_sc0000965.1_g000025 Rmu_sc0001718.1_g000001 Rmu_sc0001719.1_g000020 Rmu_sc0001822.1_g000025 Rmu_sc0002219.1_g000003 Rmu_sc0002460.1_g000059 Rmu_sc0002757.1_g000001 Rmu_sc0002860.1_g000001 Rmu_sc0004531.1_g000001 Rmu_sc0005558.1_g000003 Rmu_sc0011218.1_g000001 Rmu_sc0011998.1_g000003 Rmu_sc0015560.1_g000002 Rmu_sc0015560.1_g000003
rosa_roxburghii Rroxscaffold_1G00004200 Rroxscaffold_1G00026570 Rroxscaffold_1G00040370 Rroxscaffold_1G00044120 Rroxscaffold_1G00049590 Rroxscaffold_1G00059030 Rroxscaffold_2G00108440 Rroxscaffold_2G00108850 Rroxscaffold_2G00130680 Rroxscaffold_2G00132980 Rroxscaffold_2G00136860 Rroxscaffold_3G00218610 Rroxscaffold_4G00309940 Rroxscaffold_6G00405560
rosa_rugosa Rorug02G0138000 Rorug02G0138100 Rorug02G0138100 Rorug06G0154000
rosa_samantha Rh1AG121500 Rh1CG116300 Rh2AG189000 Rh2AG509600 Rh2BG200200 Rh2CG194100 Rh2DG195300 Rh5AG114400 Rh5DG488800
rosa_wichuraiana Rw0G022020 Rw1G023650 Rw1G026380 Rw1G034750 Rw1G040770 Rw2G014870 Rw2G016560 Rw4G031190 Rw5G026570 Rw6G003020 Rw6G012060 Rw7G014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 799
AcsI RAATTY 1 cut(s) 566
AcuI CTGAAG 1 cut(s) 215
AfiI CCNNNNNNNGG 2 cut(s) 363, 679
AflII CTTAAG 1 cut(s) 644
AgsI TTSAA 9 cut(s) 62, 79, 133, 226, 235, 311, 446, 563, 688
AjuI GAANNNNNNNTTGG 2 cut(s) 680, 712
AloI GAACNNNNNNTCC 2 cut(s) 648, 680
AluBI AGCT 3 cut(s) 57, 353, 392
AluI AGCT 3 cut(s) 57, 353, 392
Alw21I GWGCWC 1 cut(s) 482
Alw26I GTCTC 1 cut(s) 478
AlwI GGATC 1 cut(s) 799
AlwNI CAGNNNCTG 1 cut(s) 593
ApeKI GCWGC 1 cut(s) 350
ApoI RAATTY 1 cut(s) 566
AspS9I GGNCC 1 cut(s) 397
AsuHPI GGTGA 1 cut(s) 23
AvaII GGWCC 1 cut(s) 397
BaeGI GKGCMC 1 cut(s) 782
BauI CACGAG 1 cut(s) 481
Bbv12I GWGCWC 1 cut(s) 482
BbvCI CCTCAGC 1 cut(s) 393
BbvI GCAGC 1 cut(s) 362
BccI CCATC 3 cut(s) 365, 406, 431
BciVI GTATCC 1 cut(s) 328
BcoDI GTCTC 1 cut(s) 478
BfaI CTAG 4 cut(s) 54, 102, 381, 668
BfmI CTRYAG 1 cut(s) 600
BfrI CTTAAG 1 cut(s) 644
BfuI GTATCC 1 cut(s) 328
BisI GCNGC 1 cut(s) 351
BlsI GCNGC 1 cut(s) 352
Bme18I GGWCC 1 cut(s) 397
BmgT120I GGNCC 1 cut(s) 397
BmsI GCATC 1 cut(s) 586
BplI GAGNNNNNCTC 2 cut(s) 475, 507
BpmI CTGGAG 1 cut(s) 408
Bpu10I CCTNAGC 2 cut(s) 393, 636
Bsa29I ATCGAT 1 cut(s) 622
BsaXI ACNNNNNCTCC 2 cut(s) 381, 411
Bsc4I CCNNNNNNNGG 2 cut(s) 363, 679
Bse1I ACTGG 2 cut(s) 127, 391
BseCI ATCGAT 1 cut(s) 622
BseLI CCNNNNNNNGG 2 cut(s) 363, 679
BseMII CTCAG 2 cut(s) 384, 506
BseNI ACTGG 2 cut(s) 127, 391
BseRI GAGGAG 1 cut(s) 431
BseSI GKGCMC 1 cut(s) 782
BseXI GCAGC 1 cut(s) 362
BshVI ATCGAT 1 cut(s) 622
BsiHKAI GWGCWC 1 cut(s) 482
BslFI GGGAC 2 cut(s) 165, 669
BslI CCNNNNNNNGG 2 cut(s) 363, 679
BsmAI GTCTC 1 cut(s) 478
BsmFI GGGAC 2 cut(s) 165, 669
BsmI GAATGC 2 cut(s) 166, 585
Bsp1286I GDGCHC 2 cut(s) 482, 782
Bsp143I GATC 2 cut(s) 619, 791
BspCNI CTCAG 2 cut(s) 385, 505
BspDI ATCGAT 1 cut(s) 622
BspPI GGATC 1 cut(s) 799
BspTI CTTAAG 1 cut(s) 644
BsrI ACTGG 2 cut(s) 127, 391
BssMI GATC 2 cut(s) 619, 791
BssSI CACGAG 1 cut(s) 481
Bst2BI CACGAG 1 cut(s) 481
BstAFI CTTAAG 1 cut(s) 644
BstC8I GCNNGC 2 cut(s) 543, 585
BstDEI CTNAG 4 cut(s) 393, 492, 636, 733
BstKTI GATC 2 cut(s) 622, 794
BstMAI GTCTC 1 cut(s) 478
BstMBI GATC 2 cut(s) 619, 791
BstSFI CTRYAG 1 cut(s) 600
BstSLI GKGCMC 1 cut(s) 782
BstV1I GCAGC 1 cut(s) 362
BstX2I RGATCY 1 cut(s) 791
BstYI RGATCY 1 cut(s) 791
Bsu15I ATCGAT 1 cut(s) 622
BsuI GTATCC 1 cut(s) 328
BsuTUI ATCGAT 1 cut(s) 622
BtsI GCAGTG 1 cut(s) 594
BtsIMutI CAGTG 3 cut(s) 120, 594, 780
Cac8I GCNNGC 2 cut(s) 543, 585
CaiI CAGNNNCTG 1 cut(s) 593
Cfr13I GGNCC 1 cut(s) 397
ClaI ATCGAT 1 cut(s) 622
CviAII CATG 6 cut(s) 262, 285, 374, 401, 469, 727
CviJI RGCY 5 cut(s) 57, 353, 392, 465, 706
CviKI_1 RGCY 5 cut(s) 57, 353, 392, 465, 706
DdeI CTNAG 4 cut(s) 393, 492, 636, 733
DpnI GATC 2 cut(s) 621, 793
DpnII GATC 2 cut(s) 619, 791
DraI TTTAAA 1 cut(s) 168
Eco32I GATATC 1 cut(s) 295
Eco47I GGWCC 1 cut(s) 397
Eco57I CTGAAG 1 cut(s) 215
EcoRV GATATC 1 cut(s) 295
FaeI CATG 6 cut(s) 265, 288, 377, 404, 472, 730
FaqI GGGAC 2 cut(s) 165, 669
FatI CATG 6 cut(s) 261, 284, 373, 400, 468, 726
Fnu4HI GCNGC 1 cut(s) 351
Fsp4HI GCNGC 1 cut(s) 351
FspBI CTAG 4 cut(s) 54, 102, 381, 668
GluI GCNGC 1 cut(s) 351
GsuI CTGGAG 1 cut(s) 408
Hin1II CATG 6 cut(s) 265, 288, 377, 404, 472, 730
HinfI GANTC 2 cut(s) 68, 215
HphI GGTGA 1 cut(s) 23
Hpy166II GTNNAC 1 cut(s) 206
Hpy188I TCNGA 2 cut(s) 195, 504
Hpy188III TCNNGA 3 cut(s) 86, 157, 668
Hpy8I GTNNAC 1 cut(s) 206
HpyAV CCTTC 1 cut(s) 190
HpyCH4V TGCA 5 cut(s) 284, 306, 350, 545, 583
HpyF3I CTNAG 4 cut(s) 393, 492, 636, 733
Hsp92II CATG 6 cut(s) 265, 288, 377, 404, 472, 730
Kzo9I GATC 2 cut(s) 619, 791
LmnI GCTCC 2 cut(s) 389, 418
LpnPI CCDG 3 cut(s) 108, 372, 479
Lsp1109I GCAGC 1 cut(s) 362
LweI GCATC 1 cut(s) 586
MaeI CTAG 4 cut(s) 54, 102, 381, 668
MaeIII GTNAC 3 cut(s) 139, 368, 589
MalI GATC 2 cut(s) 621, 793
MboI GATC 2 cut(s) 619, 791
MboII GAAGA 8 cut(s) 74, 77, 238, 247, 446, 539, 575, 629
MflI RGATCY 1 cut(s) 791
MhlI GDGCHC 2 cut(s) 482, 782
MluCI AATT 7 cut(s) 93, 184, 230, 554, 566, 675, 690
MlyI GAGTC 1 cut(s) 224
MnlI CCTC 4 cut(s) 98, 388, 409, 782
MseI TTAA 3 cut(s) 167, 645, 678
MslI CAYNNNNRTG 1 cut(s) 473
MspCI CTTAAG 1 cut(s) 644
Mva1269I GAATGC 2 cut(s) 166, 585
NdeII GATC 2 cut(s) 619, 791
NlaIII CATG 6 cut(s) 265, 288, 377, 404, 472, 730
NmuCI GTSAC 2 cut(s) 368, 589
PctI GAATGC 2 cut(s) 166, 585
PfeI GAWTC 1 cut(s) 68
PkrI GCNGC 1 cut(s) 352
PleI GAGTC 1 cut(s) 223
PpsI GAGTC 1 cut(s) 223
PspPI GGNCC 1 cut(s) 397
PstNI CAGNNNCTG 1 cut(s) 593
PsuI RGATCY 1 cut(s) 791
RseI CAYNNNNRTG 1 cut(s) 473
SaqAI TTAA 3 cut(s) 167, 645, 678
SatI GCNGC 1 cut(s) 351
Sau3AI GATC 2 cut(s) 619, 791
Sau96I GGNCC 1 cut(s) 397
SchI GAGTC 1 cut(s) 224
SduI GDGCHC 2 cut(s) 482, 782
SetI ASST 6 cut(s) 59, 355, 394, 399, 498, 613
SfaNI GCATC 1 cut(s) 586
SfcI CTRYAG 1 cut(s) 600
SinI GGWCC 1 cut(s) 397
SmiMI CAYNNNNRTG 1 cut(s) 473
SmlI CTYRAG 1 cut(s) 644
SmoI CTYRAG 1 cut(s) 644
Sse9I AATT 7 cut(s) 93, 184, 230, 554, 566, 675, 690
SspMI CTAG 4 cut(s) 54, 102, 381, 668
TaqI TCGA 2 cut(s) 156, 622
TasI AATT 7 cut(s) 93, 184, 230, 554, 566, 675, 690
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 3 cut(s) 167, 645, 678
Tru9I TTAA 3 cut(s) 167, 645, 678
TscAI CASTG 3 cut(s) 127, 594, 787
TseFI GTSAC 2 cut(s) 368, 589
TseI GCWGC 1 cut(s) 350
Tsp45I GTSAC 2 cut(s) 368, 589
TspDTI ATGAA 8 cut(s) 30, 281, 339, 447, 540, 630, 715, 756
TspGWI ACGGA 1 cut(s) 105
TspRI CASTG 3 cut(s) 127, 594, 787
Vha464I CTTAAG 1 cut(s) 644
VpaK11BI GGWCC 1 cut(s) 397
XapI RAATTY 1 cut(s) 566
XbaI TCTAGA 1 cut(s) 667
XspI CTAG 4 cut(s) 54, 102, 381, 668
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.