Rmu_sc0002460.1_g000059
MYB Family

nuclease HARBI1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002460.1
OG0000261
Physical Location & Seq
Reverse (-)
259249 .. 259650
402 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002460.1_g000059.1.cds

Sequence Viewer

Length: 402 bp
atgatggaggagcagtgcaacaatgaagatgatataggccttgagaatgacacaagccctatgtcaatgagcaaagatagcacgggacaatctcaagtcaatcagaaaaagaggaaaagaaattatgaagataaaattatgcttgcattggataaattgtttgaagactctggaaaaagaatccaatcggtgactgatgccatagtgaaaggtaatgaagatcgatatgatattgctaaggaacttaagaaaatgggactttctgttctagaccaaattgaggcattgaaaatcattttggataagccccaaagcatctttgtgttcatgtccttagatgatgaagtgagaaaagtgtatgtcgagaattttcttgcgggcattgctagaggatctacctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

133

Amino Acids

15.13

Weight (kDa)

4.86

Isoelectric Point (pI)

47.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000261)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18411 FvH4_1g22560 FvH4_1g24290 FvH4_1g24290 FvH4_1g24290 FvH4_1g29434 FvH4_2g04031 FvH4_2g04811 FvH4_2g07610 FvH4_2g09412 FvH4_3g15552 FvH4_3g30720 FvH4_4g05810 FvH4_4g09541 FvH4_4g15171 FvH4_6g09145 FvH4_6g49541 FvH4_7g00320 FvH4_7g11552
malus_domestica MD00G1072400.v1.1 MD01G1188100.v1.1 MD07G1132000.v1.1 MD08G1190700.v1.1 MD10G1011200.v1.1 MD14G1164100.v1.1 MD15G1289200.v1.1 MD15G1289300.v1.1 MD17G1245100.v1.1
prunus_persica Prupe.6G228600_v2.0.a1
pyrus_communis pycom01g07070 pycom02g06890 pycom02g06900 pycom02g13930 pycom04g07470 pycom04g11770 pycom04g21930 pycom05g08520 pycom06g04490 pycom06g09560 pycom07g03750 pycom08g08760 pycom08g13660 pycom09g11520 pycom09g14250 pycom09g14770 pycom10g00720 pycom10g01290 pycom10g10480 pycom10g15700 pycom12420g00130 pycom12g05380 pycom12g08750 pycom13g19010 pycom13g29080 pycom14g06210 pycom14g13680 pycom14g19850 pycom15g22070 pycom15g23440 pycom15g24950 pycom15g25280 pycom16g11100 pycom16g17080 pycom16g26310 pycom17g15650 pycom17g15670 pycom17g20370
rosa_chinensis RchiOBHm_Chr1g0373591 RchiOBHm_Chr2g0105551 RchiOBHm_Chr2g0106711 RchiOBHm_Chr2g0106721 RchiOBHm_Chr7g0219611
rosa_laevigata RLG00000013773 RLG00000017436 RLG00000017533
rosa_multiflora Rmu_co8001842.1_g000001 Rmu_co8158450.1_g000001 Rmu_sc0000516.1_g000067 Rmu_sc0000566.1_g000009 Rmu_sc0000965.1_g000025 Rmu_sc0001718.1_g000001 Rmu_sc0001719.1_g000020 Rmu_sc0001822.1_g000025 Rmu_sc0002219.1_g000003 Rmu_sc0002460.1_g000059 Rmu_sc0002757.1_g000001 Rmu_sc0002860.1_g000001 Rmu_sc0004531.1_g000001 Rmu_sc0005558.1_g000003 Rmu_sc0011218.1_g000001 Rmu_sc0011998.1_g000003 Rmu_sc0015560.1_g000002 Rmu_sc0015560.1_g000003
rosa_roxburghii Rroxscaffold_1G00004200 Rroxscaffold_1G00026570 Rroxscaffold_1G00040370 Rroxscaffold_1G00044120 Rroxscaffold_1G00049590 Rroxscaffold_1G00059030 Rroxscaffold_2G00108440 Rroxscaffold_2G00108850 Rroxscaffold_2G00130680 Rroxscaffold_2G00132980 Rroxscaffold_2G00136860 Rroxscaffold_3G00218610 Rroxscaffold_4G00309940 Rroxscaffold_6G00405560
rosa_rugosa Rorug02G0138000 Rorug02G0138100 Rorug02G0138100 Rorug06G0154000
rosa_samantha Rh1AG121500 Rh1CG116300 Rh2AG189000 Rh2AG509600 Rh2BG200200 Rh2CG194100 Rh2DG195300 Rh5AG114400 Rh5DG488800
rosa_wichuraiana Rw0G022020 Rw1G023650 Rw1G026380 Rw1G034750 Rw1G040770 Rw2G014870 Rw2G016560 Rw4G031190 Rw5G026570 Rw6G003020 Rw6G012060 Rw7G014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 377
AclWI GGATC 1 cut(s) 400
AcsI RAATTY 1 cut(s) 367
AfiI CCNNNNNNNGG 1 cut(s) 280
AflII CTTAAG 1 cut(s) 245
AgsI TTSAA 2 cut(s) 164, 289
AjuI GAANNNNNNNTTGG 2 cut(s) 281, 313
AloI GAACNNNNNNTCC 2 cut(s) 249, 281
AlwI GGATC 1 cut(s) 400
AoxI GGCC 1 cut(s) 37
ApoI RAATTY 1 cut(s) 367
AsuHPI GGTGA 1 cut(s) 202
BbsI GAAGAC 1 cut(s) 171
BfaI CTAG 3 cut(s) 269, 387, 400
BfrI CTTAAG 1 cut(s) 245
BmsI GCATC 2 cut(s) 187, 324
BpiI GAAGAC 1 cut(s) 171
Bpu10I CCTNAGC 1 cut(s) 237
BpuEI CTTGAG 2 cut(s) 62, 78
Bsa29I ATCGAT 1 cut(s) 223
BsaXI ACNNNNNCTCC 1 cut(s) 29
Bsc4I CCNNNNNNNGG 1 cut(s) 280
Bse3DI GCAATG 1 cut(s) 381
BseCI ATCGAT 1 cut(s) 223
BseLI CCNNNNNNNGG 1 cut(s) 280
BseMI GCAATG 1 cut(s) 381
BseRI GAGGAG 1 cut(s) 23
BshFI GGCC 1 cut(s) 39
BshVI ATCGAT 1 cut(s) 223
BslFI GGGAC 2 cut(s) 99, 270
BslI CCNNNNNNNGG 1 cut(s) 280
BsmFI GGGAC 2 cut(s) 99, 270
BsnI GGCC 1 cut(s) 39
Bsp143I GATC 2 cut(s) 220, 392
BspACI CCGC 1 cut(s) 377
BspANI GGCC 1 cut(s) 39
BspDI ATCGAT 1 cut(s) 223
BspPI GGATC 1 cut(s) 400
BspTI CTTAAG 1 cut(s) 245
BsrDI GCAATG 1 cut(s) 381
BssMI GATC 2 cut(s) 220, 392
BstAFI CTTAAG 1 cut(s) 245
BstC8I GCNNGC 2 cut(s) 144, 379
BstDEI CTNAG 2 cut(s) 237, 334
BstKTI GATC 2 cut(s) 223, 395
BstMBI GATC 2 cut(s) 220, 392
BstMWI GCNNNNNNNGC 2 cut(s) 78, 383
BstV2I GAAGAC 1 cut(s) 171
BstX2I RGATCY 1 cut(s) 392
BstYI RGATCY 1 cut(s) 392
Bsu15I ATCGAT 1 cut(s) 223
BsuRI GGCC 1 cut(s) 39
BsuTUI ATCGAT 1 cut(s) 223
BtsI GCAGTG 1 cut(s) 20
BtsIMutI CAGTG 1 cut(s) 20
Cac8I GCNNGC 2 cut(s) 144, 379
ClaI ATCGAT 1 cut(s) 223
CviAII CATG 1 cut(s) 328
CviJI RGCY 3 cut(s) 39, 57, 307
CviKI_1 RGCY 3 cut(s) 39, 57, 307
DdeI CTNAG 2 cut(s) 237, 334
DpnI GATC 2 cut(s) 222, 394
DpnII GATC 2 cut(s) 220, 392
Eco147I AGGCCT 1 cut(s) 39
FaeI CATG 1 cut(s) 331
FaiI YATR 8 cut(s) 35, 62, 126, 140, 203, 228, 329, 360
FaqI GGGAC 2 cut(s) 99, 270
FatI CATG 1 cut(s) 327
FauI CCCGC 1 cut(s) 370
FspBI CTAG 3 cut(s) 269, 387, 400
HaeIII GGCC 1 cut(s) 39
Hin1II CATG 1 cut(s) 331
HinfI GANTC 2 cut(s) 167, 180
HphI GGTGA 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 105
Hpy188III TCNNGA 3 cut(s) 171, 269, 364
HpyCH4V TGCA 2 cut(s) 18, 146
HpyF10VI GCNNNNNNNGC 2 cut(s) 78, 383
HpyF3I CTNAG 2 cut(s) 237, 334
Hsp92II CATG 1 cut(s) 331
Kzo9I GATC 2 cut(s) 220, 392
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 1 cut(s) 156
LweI GCATC 2 cut(s) 187, 324
MaeI CTAG 3 cut(s) 269, 387, 400
MaeIII GTNAC 1 cut(s) 190
MalI GATC 2 cut(s) 222, 394
MboI GATC 2 cut(s) 220, 392
MboII GAAGA 4 cut(s) 38, 140, 176, 230
MflI RGATCY 1 cut(s) 392
MluCI AATT 5 cut(s) 121, 135, 155, 276, 367
MlyI GAGTC 1 cut(s) 161
MnlI CCTC 3 cut(s) 105, 274, 383
MseI TTAA 1 cut(s) 246
MslI CAYNNNNRTG 1 cut(s) 320
MspCI CTTAAG 1 cut(s) 245
MwoI GCNNNNNNNGC 2 cut(s) 78, 383
NdeII GATC 2 cut(s) 220, 392
NlaIII CATG 1 cut(s) 331
NmuCI GTSAC 1 cut(s) 190
PceI AGGCCT 1 cut(s) 39
PfeI GAWTC 1 cut(s) 180
PleI GAGTC 1 cut(s) 161
PpsI GAGTC 1 cut(s) 161
PsuI RGATCY 1 cut(s) 392
RseI CAYNNNNRTG 1 cut(s) 320
SaqAI TTAA 1 cut(s) 246
Sau3AI GATC 2 cut(s) 220, 392
SchI GAGTC 1 cut(s) 161
SetI ASST 2 cut(s) 214, 401
SfaNI GCATC 2 cut(s) 187, 324
SmiMI CAYNNNNRTG 1 cut(s) 320
SmlI CTYRAG 3 cut(s) 41, 93, 245
SmoI CTYRAG 3 cut(s) 41, 93, 245
Sse9I AATT 5 cut(s) 121, 135, 155, 276, 367
SseBI AGGCCT 1 cut(s) 39
SsiI CCGC 1 cut(s) 377
SspMI CTAG 3 cut(s) 269, 387, 400
StuI AGGCCT 1 cut(s) 39
TaqI TCGA 2 cut(s) 223, 363
TasI AATT 5 cut(s) 121, 135, 155, 276, 367
TfiI GAWTC 1 cut(s) 180
Tru1I TTAA 1 cut(s) 246
Tru9I TTAA 1 cut(s) 246
TscAI CASTG 1 cut(s) 20
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
TspDTI ATGAA 5 cut(s) 39, 141, 231, 316, 357
TspRI CASTG 1 cut(s) 20
Vha464I CTTAAG 1 cut(s) 245
XapI RAATTY 1 cut(s) 367
XbaI TCTAGA 1 cut(s) 268
XspI CTAG 3 cut(s) 269, 387, 400
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.