Rmu_sc0001719.1_g000020
MYB Family

isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001719.1
OG0000261
Physical Location & Seq
Reverse (-)
114694 .. 115316
623 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001719.1_g000020.1.cds

Sequence Viewer

Length: 534 bp
atgaacaagagtggatttgcatggaatgatgtcaaaaagtgcattgaagttgatagtaatgaagtatgggatgcatatttgcagcacaacaaaaaggcaaagggatggagaaacaagaagtatccattatttaatagagtagctaccatctttgggagtgaccatgctactggaaatggggttgaggtccctgctgatatgatggaggagcagagcaacaatgaagatgatataggccttgagaatgacacaagccccatgtcaatgagtaaagatagcacgggacaaactcaggtcagtcagaaaaagaggaaaagaaattatgaagataaaattatgcttgcattggataaattgtttgaagaatatggaaaaagaatgcaagcagtgactaatgctataatgaaaggtaatgaagatcaatctgatattgctaaggaacttaagaaaatgggactttctgttctagaccaaattgaggcattgaaaatcattttggataagccccaaatatctctgtgttcatgtccttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

177

Amino Acids

20.05

Weight (kDa)

5.79

Isoelectric Point (pI)

49.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000261)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18411 FvH4_1g22560 FvH4_1g24290 FvH4_1g24290 FvH4_1g24290 FvH4_1g29434 FvH4_2g04031 FvH4_2g04811 FvH4_2g07610 FvH4_2g09412 FvH4_3g15552 FvH4_3g30720 FvH4_4g05810 FvH4_4g09541 FvH4_4g15171 FvH4_6g09145 FvH4_6g49541 FvH4_7g00320 FvH4_7g11552
malus_domestica MD00G1072400.v1.1 MD01G1188100.v1.1 MD07G1132000.v1.1 MD08G1190700.v1.1 MD10G1011200.v1.1 MD14G1164100.v1.1 MD15G1289200.v1.1 MD15G1289300.v1.1 MD17G1245100.v1.1
prunus_persica Prupe.6G228600_v2.0.a1
pyrus_communis pycom01g07070 pycom02g06890 pycom02g06900 pycom02g13930 pycom04g07470 pycom04g11770 pycom04g21930 pycom05g08520 pycom06g04490 pycom06g09560 pycom07g03750 pycom08g08760 pycom08g13660 pycom09g11520 pycom09g14250 pycom09g14770 pycom10g00720 pycom10g01290 pycom10g10480 pycom10g15700 pycom12420g00130 pycom12g05380 pycom12g08750 pycom13g19010 pycom13g29080 pycom14g06210 pycom14g13680 pycom14g19850 pycom15g22070 pycom15g23440 pycom15g24950 pycom15g25280 pycom16g11100 pycom16g17080 pycom16g26310 pycom17g15650 pycom17g15670 pycom17g20370
rosa_chinensis RchiOBHm_Chr1g0373591 RchiOBHm_Chr2g0105551 RchiOBHm_Chr2g0106711 RchiOBHm_Chr2g0106721 RchiOBHm_Chr7g0219611
rosa_laevigata RLG00000013773 RLG00000017436 RLG00000017533
rosa_multiflora Rmu_co8001842.1_g000001 Rmu_co8158450.1_g000001 Rmu_sc0000516.1_g000067 Rmu_sc0000566.1_g000009 Rmu_sc0000965.1_g000025 Rmu_sc0001718.1_g000001 Rmu_sc0001719.1_g000020 Rmu_sc0001822.1_g000025 Rmu_sc0002219.1_g000003 Rmu_sc0002460.1_g000059 Rmu_sc0002757.1_g000001 Rmu_sc0002860.1_g000001 Rmu_sc0004531.1_g000001 Rmu_sc0005558.1_g000003 Rmu_sc0011218.1_g000001 Rmu_sc0011998.1_g000003 Rmu_sc0015560.1_g000002 Rmu_sc0015560.1_g000003
rosa_roxburghii Rroxscaffold_1G00004200 Rroxscaffold_1G00026570 Rroxscaffold_1G00040370 Rroxscaffold_1G00044120 Rroxscaffold_1G00049590 Rroxscaffold_1G00059030 Rroxscaffold_2G00108440 Rroxscaffold_2G00108850 Rroxscaffold_2G00130680 Rroxscaffold_2G00132980 Rroxscaffold_2G00136860 Rroxscaffold_3G00218610 Rroxscaffold_4G00309940 Rroxscaffold_6G00405560
rosa_rugosa Rorug02G0138000 Rorug02G0138100 Rorug02G0138100 Rorug06G0154000
rosa_samantha Rh1AG121500 Rh1CG116300 Rh2AG189000 Rh2AG509600 Rh2BG200200 Rh2CG194100 Rh2DG195300 Rh5AG114400 Rh5DG488800
rosa_wichuraiana Rw0G022020 Rw1G023650 Rw1G026380 Rw1G034750 Rw1G040770 Rw2G014870 Rw2G016560 Rw4G031190 Rw5G026570 Rw6G003020 Rw6G012060 Rw7G014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 153, 478
AflII CTTAAG 1 cut(s) 443
AgsI TTSAA 3 cut(s) 47, 362, 487
AjuI GAANNNNNNNTTGG 2 cut(s) 479, 511
AloI GAACNNNNNNTCC 2 cut(s) 447, 479
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
AoxI GGCC 1 cut(s) 235
ApeKI GCWGC 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 187
AvaII GGWCC 1 cut(s) 187
BbvI GCAGC 1 cut(s) 94
BccI CCATC 3 cut(s) 99, 155, 196
BciVI GTATCC 1 cut(s) 132
BfaI CTAG 1 cut(s) 467
BfrI CTTAAG 1 cut(s) 443
BfuI GTATCC 1 cut(s) 132
BisI GCNGC 1 cut(s) 83
BlsI GCNGC 1 cut(s) 84
Bme18I GGWCC 1 cut(s) 187
BmgT120I GGNCC 1 cut(s) 187
BmiI GGNNCC 1 cut(s) 189
BmsI GCATC 1 cut(s) 61
Bpu10I CCTNAGC 1 cut(s) 435
BpuEI CTTGAG 1 cut(s) 260
Bsc4I CCNNNNNNNGG 2 cut(s) 153, 478
Bse1I ACTGG 1 cut(s) 175
BseGI GGATG 2 cut(s) 76, 110
BseLI CCNNNNNNNGG 2 cut(s) 153, 478
BseMII CTCAG 1 cut(s) 305
BseNI ACTGG 1 cut(s) 175
BseRI GAGGAG 1 cut(s) 221
BseXI GCAGC 1 cut(s) 94
BshFI GGCC 1 cut(s) 237
BslFI GGGAC 3 cut(s) 173, 297, 468
BslI CCNNNNNNNGG 2 cut(s) 153, 478
BsmFI GGGAC 3 cut(s) 173, 297, 468
BsmI GAATGC 1 cut(s) 384
BsnI GGCC 1 cut(s) 237
Bsp143I GATC 1 cut(s) 418
BspANI GGCC 1 cut(s) 237
BspCNI CTCAG 1 cut(s) 304
BspLI GGNNCC 1 cut(s) 189
BspTI CTTAAG 1 cut(s) 443
BsrI ACTGG 1 cut(s) 175
BssMI GATC 1 cut(s) 418
BstAFI CTTAAG 1 cut(s) 443
BstC8I GCNNGC 2 cut(s) 342, 384
BstDEI CTNAG 3 cut(s) 291, 435, 531
BstF5I GGATG 2 cut(s) 76, 110
BstKTI GATC 1 cut(s) 421
BstMBI GATC 1 cut(s) 418
BstV1I GCAGC 1 cut(s) 94
BstXI CCANNNNNNTGG 1 cut(s) 170
BsuI GTATCC 1 cut(s) 132
BsuRI GGCC 1 cut(s) 237
BtsCI GGATG 2 cut(s) 76, 110
BtsI GCAGTG 1 cut(s) 393
BtsIMutI CAGTG 1 cut(s) 393
Cac8I GCNNGC 2 cut(s) 342, 384
Cfr13I GGNCC 1 cut(s) 187
CviAII CATG 4 cut(s) 21, 164, 259, 525
CviJI RGCY 4 cut(s) 143, 237, 255, 505
CviKI_1 RGCY 4 cut(s) 143, 237, 255, 505
DdeI CTNAG 3 cut(s) 291, 435, 531
DpnI GATC 1 cut(s) 420
DpnII GATC 1 cut(s) 418
Eco147I AGGCCT 1 cut(s) 237
Eco47I GGWCC 1 cut(s) 187
EcoO109I RGGNCCY 1 cut(s) 187
EcoT22I ATGCAT 1 cut(s) 76
FaeI CATG 4 cut(s) 24, 167, 262, 528
FaqI GGGAC 3 cut(s) 173, 297, 468
FatI CATG 4 cut(s) 20, 163, 258, 524
Fnu4HI GCNGC 1 cut(s) 83
FokI GGATG 2 cut(s) 83, 117
Fsp4HI GCNGC 1 cut(s) 83
FspBI CTAG 1 cut(s) 467
GluI GCNGC 1 cut(s) 83
HaeIII GGCC 1 cut(s) 237
Hin1II CATG 4 cut(s) 24, 167, 262, 528
Hpy188I TCNGA 2 cut(s) 303, 427
Hpy188III TCNNGA 1 cut(s) 467
HpyCH4V TGCA 6 cut(s) 20, 42, 74, 82, 344, 382
HpyF3I CTNAG 3 cut(s) 291, 435, 531
Hsp92II CATG 4 cut(s) 24, 167, 262, 528
Kzo9I GATC 1 cut(s) 418
LmnI GCTCC 1 cut(s) 208
LpnPI CCDG 3 cut(s) 156, 204, 278
Lsp1109I GCAGC 1 cut(s) 94
LweI GCATC 1 cut(s) 61
MaeI CTAG 1 cut(s) 467
MaeIII GTNAC 2 cut(s) 158, 388
MalI GATC 1 cut(s) 420
MboI GATC 1 cut(s) 418
MboII GAAGA 4 cut(s) 236, 338, 374, 428
MluCI AATT 4 cut(s) 319, 333, 353, 474
MnlI CCTC 4 cut(s) 178, 199, 303, 472
Mph1103I ATGCAT 1 cut(s) 76
MseI TTAA 2 cut(s) 132, 444
MslI CAYNNNNRTG 1 cut(s) 263
MspCI CTTAAG 1 cut(s) 443
Mva1269I GAATGC 1 cut(s) 384
NdeII GATC 1 cut(s) 418
NlaIII CATG 4 cut(s) 24, 167, 262, 528
NlaIV GGNNCC 1 cut(s) 189
NmuCI GTSAC 2 cut(s) 158, 388
NsiI ATGCAT 1 cut(s) 76
PceI AGGCCT 1 cut(s) 237
PctI GAATGC 1 cut(s) 384
PkrI GCNGC 1 cut(s) 84
PpuMI RGGWCCY 1 cut(s) 187
Psp5II RGGWCCY 1 cut(s) 187
PspN4I GGNNCC 1 cut(s) 189
PspPI GGNCC 1 cut(s) 187
PspPPI RGGWCCY 1 cut(s) 187
RseI CAYNNNNRTG 1 cut(s) 263
SaqAI TTAA 2 cut(s) 132, 444
SatI GCNGC 1 cut(s) 83
Sau3AI GATC 1 cut(s) 418
Sau96I GGNCC 1 cut(s) 187
SetI ASST 4 cut(s) 145, 189, 297, 412
SfaNI GCATC 1 cut(s) 61
SinI GGWCC 1 cut(s) 187
SmiMI CAYNNNNRTG 1 cut(s) 263
SmlI CTYRAG 2 cut(s) 239, 443
SmoI CTYRAG 2 cut(s) 239, 443
Sse9I AATT 4 cut(s) 319, 333, 353, 474
SseBI AGGCCT 1 cut(s) 237
SspMI CTAG 1 cut(s) 467
StuI AGGCCT 1 cut(s) 237
TasI AATT 4 cut(s) 319, 333, 353, 474
Tru1I TTAA 2 cut(s) 132, 444
Tru9I TTAA 2 cut(s) 132, 444
TscAI CASTG 1 cut(s) 393
TseFI GTSAC 2 cut(s) 158, 388
TseI GCWGC 1 cut(s) 82
Tsp45I GTSAC 2 cut(s) 158, 388
TspDTI ATGAA 7 cut(s) 17, 75, 237, 339, 419, 429, 513
TspRI CASTG 1 cut(s) 393
Vha464I CTTAAG 1 cut(s) 443
VpaK11BI GGWCC 1 cut(s) 187
XbaI TCTAGA 1 cut(s) 466
XspI CTAG 1 cut(s) 467
Zsp2I ATGCAT 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.