Rmu_co8233911.1_g000001

Belongs to the GRAS family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8233911.1
OG0000175
Physical Location & Seq
Forward (+)
1 .. 582
582 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8233911.1_g000001.1.cds

Sequence Viewer

Length: 582 bp
cagaattgggaatccatccaagtagaggacctcaaggttgagaggaatgaggtgcttgctgtgaattgtatgttacggtttaagaacctactggatgagactgttgaagtaaactgtccaagagattctgttctaaagctaatcaggaggttgaaaccagatatttttgttcatactattgttaatggtgcctacaatgcccccttctttgtcactcgatttcgggaggccctcttccacttctctgccttgtatgatgtatttgatgttaatataccccgtgacagttcagagaggttgatgtttgaatcagagttctatggccgggaggccatgaatgtgatagcatgtgaggggatagagagggttgagagagctgagacatacaagcaatggcaggtacgttgtcaaagggctggtttacagttgttgccattggaccaagaggtagtgaaggtgtttagggataaggtgaaggcatggtaccacaaagatttcgcaattgatcaagatagtgattggatgcttcaaggatggaagggtcgaattgtctatgcttcttcttgttgggtgcctgcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GRAS

Protein Analysis

193

Amino Acids

22.8

Weight (kDa)

5.72

Isoelectric Point (pI)

42.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000175)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G46600 AT3G46600 AT3G46600 AT5G59450
fragaria_vesca FvH4_3g36690 FvH4_3g36690 FvH4_3g36690 FvH4_3g36690 FvH4_3g36690 FvH4_3g36690 FvH4_3g36691 FvH4_3g36700 FvH4_3g36711 FvH4_3g36711 FvH4_3g36720 FvH4_3g36730 FvH4_3g36760
malus_domestica MD03G1088900.v1.1 MD03G1089100.v1.1 MD03G1089200.v1.1 MD03G1089300.v1.1 MD11G1097900.v1.1 MD11G1098000.v1.1 MD11G1098100.v1.1 MD11G1098400.v1.1 MD11G1098900.v1.1
prunus_persica Prupe.6G073300_v2.0.a1 Prupe.6G073400_v2.0.a1 Prupe.6G073400_v2.0.a1 Prupe.6G073500_v2.0.a1 Prupe.6G073600_v2.0.a1 Prupe.6G073700_v2.0.a1 Prupe.6G073800_v2.0.a1 Prupe.I004400_v2.0.a1 Prupe.I004500_v2.0.a1
pyrus_communis pycom03g07050 pycom03g07060 pycom03g07070 pycom03g07110 pycom04g11870 pycom11g08270 pycom11g08280
rosa_chinensis RchiOBHm_Chr5g0065591 RchiOBHm_Chr5g0065601 RchiOBHm_Chr5g0065621 RchiOBHm_Chr5g0065631 RchiOBHm_Chr5g0065641 RchiOBHm_Chr5g0065651 RchiOBHm_Chr5g0065671 RchiOBHm_Chr5g0065721 RchiOBHm_Chr5g0065731 RchiOBHm_Chr5g0065751 RchiOBHm_Chr5g0065791 RchiOBHm_Chr5g0065811
rosa_laevigata RLG00000035800 RLG00000035801 RLG00000035803 RLG00000035804 RLG00000035805 RLG00000035806 RLG00000035807 RLG00000035808 RLG00000035809 RLG00000035810 RLG00000035813 RLG00000035814 RLG00000035816
rosa_multiflora Rmu_co8233911.1_g000001 Rmu_co8258053.1_g000001 Rmu_co8279117.1_g000001 Rmu_sc0000235.1_g000004 Rmu_sc0000235.1_g000024 Rmu_sc0000235.1_g000060 Rmu_sc0000235.1_g000074 Rmu_sc0001010.1_g000001 Rmu_sc0001010.1_g000015 Rmu_sc0001010.1_g000030 Rmu_sc0001010.1_g000037 Rmu_sc0001010.1_g000043 Rmu_sc0001010.1_g000063 Rmu_sc0001010.1_g000066 Rmu_sc0003636.1_g000008 Rmu_sc0003636.1_g000011 Rmu_sc0003636.1_g000012 Rmu_sc0003636.1_g000015 Rmu_sc0005971.1_g000017 Rmu_sc0008231.1_g000001 Rmu_sc0032155.1_g000001
rosa_roxburghii Rroxscaffold_1G00015360 Rroxscaffold_1G00015390 Rroxscaffold_1G00015410 Rroxscaffold_1G00015430 Rroxscaffold_1G00015490 Rroxscaffold_1G00015520 Rroxscaffold_1G00015530 Rroxscaffold_1G00015550 Rroxscaffold_1G00015560 Rroxscaffold_1G00015580 Rroxscaffold_1G00015600 Rroxscaffold_1G00015610 Rroxscaffold_1G00015620 Rroxscaffold_1G00015630
rosa_rugosa Rorug05G0372800 Rorug05G0372800 Rorug05G0372800 Rorug05G0372800 Rorug05G0373100 Rorug05G0373100 Rorug05G0373200 Rorug05G0373300 Rorug05G0373400 Rorug05G0373500 Rorug05G0373600 Rorug05G0373700 Rorug05G0378700
rosa_samantha Rh5AG430900 Rh5AG431000 Rh5AG431100 Rh5AG431200 Rh5AG431700 Rh5AG431800 Rh5AG431900 Rh5AG432200 Rh5AG432500 Rh5BG445200 Rh5BG446000 Rh5BG447100 Rh5BG447200 Rh5BG447400 Rh5BG447800 Rh5BG447900 Rh5BG448000 Rh5BG448100 Rh5BG448300 Rh5BG448400 Rh5BG448500 Rh5BG448600 Rh5CG467400 Rh5CG468000 Rh5CG469000 Rh5CG469100 Rh5CG469400 Rh5CG469700 Rh5CG469900 Rh5CG470100 Rh5CG470200 Rh5CG470600 Rh5CG470700 Rh5CG470800 Rh5DG459500 Rh5DG459700 Rh5DG459800 Rh5DG460000 Rh5DG460900 Rh5DG461300 Rh5DG461500 Rh5DG461900 Rh5DG462000 Rh5DG462100
rosa_wichuraiana Rw5G040420 Rw5G040430 Rw5G040440 Rw5G040470 Rw5G040480 Rw5G040500 Rw5G040510 Rw5G040530 Rw5G040550 Rw5G040560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 388
Acc65I GGTACC 1 cut(s) 483
AccB1I GGYRCC 3 cut(s) 188, 483, 571
AcoI YGGCCR 1 cut(s) 322
AfaI GTAC 2 cut(s) 402, 485
AfiI CCNNNNNNNGG 1 cut(s) 25
AgsI TTSAA 4 cut(s) 107, 154, 308, 530
AluBI AGCT 2 cut(s) 139, 377
AluI AGCT 2 cut(s) 139, 377
Alw26I GTCTC 2 cut(s) 92, 374
AoxI GGCC 3 cut(s) 228, 322, 330
Asp718I GGTACC 1 cut(s) 483
AspS9I GGNCC 3 cut(s) 28, 229, 439
AsuC2I CCSGG 1 cut(s) 326
AsuHPI GGTGA 1 cut(s) 484
AvaII GGWCC 2 cut(s) 28, 439
BanI GGYRCC 3 cut(s) 188, 483, 571
BarI GAAGNNNNNNTAC 2 cut(s) 467, 499
BccI CCATC 2 cut(s) 23, 528
BclI TGATCA 1 cut(s) 505
BcnI CCSGG 1 cut(s) 326
BcoDI GTCTC 2 cut(s) 92, 374
BfuAI ACCTGC 1 cut(s) 388
Bme1390I CCNGG 1 cut(s) 326
Bme18I GGWCC 2 cut(s) 28, 439
BmgT120I GGNCC 3 cut(s) 28, 229, 439
BmiI GGNNCC 3 cut(s) 190, 485, 573
BmrFI CCNGG 1 cut(s) 326
BmsI GCATC 1 cut(s) 513
BpuEI CTTGAG 1 cut(s) 17
BpuMI CCSGG 1 cut(s) 326
Bsc4I CCNNNNNNNGG 1 cut(s) 25
Bse1I ACTGG 1 cut(s) 96
Bse3DI GCAATG 1 cut(s) 398
BseGI GGATG 4 cut(s) 15, 100, 528, 539
BseLI CCNNNNNNNGG 1 cut(s) 25
BseMI GCAATG 1 cut(s) 398
BseMII CTCAG 1 cut(s) 369
BseNI ACTGG 1 cut(s) 96
BshFI GGCC 3 cut(s) 230, 324, 332
BshNI GGYRCC 3 cut(s) 188, 483, 571
BsiSI CCGG 1 cut(s) 325
BslI CCNNNNNNNGG 1 cut(s) 25
BsmAI GTCTC 2 cut(s) 92, 374
BsnI GGCC 3 cut(s) 230, 324, 332
Bsp143I GATC 1 cut(s) 505
BspANI GGCC 3 cut(s) 230, 324, 332
BspCNI CTCAG 1 cut(s) 370
BspLI GGNNCC 3 cut(s) 190, 485, 573
BspMI ACCTGC 1 cut(s) 388
BspT107I GGYRCC 3 cut(s) 188, 483, 571
BsrDI GCAATG 1 cut(s) 398
BsrI ACTGG 1 cut(s) 96
BssMI GATC 1 cut(s) 505
Bst4CI ACNGT 5 cut(s) 78, 103, 116, 287, 426
Bst6I CTCTTC 1 cut(s) 239
BstC8I GCNNGC 2 cut(s) 57, 576
BstDEI CTNAG 1 cut(s) 378
BstF5I GGATG 4 cut(s) 15, 100, 528, 539
BstKTI GATC 1 cut(s) 508
BstMAI GTCTC 2 cut(s) 92, 374
BstMBI GATC 1 cut(s) 505
BstMWI GCNNNNNNNGC 1 cut(s) 197
BstNSI RCATGY 1 cut(s) 351
BstSCI CCNGG 1 cut(s) 324
BsuRI GGCC 3 cut(s) 230, 324, 332
BtsCI GGATG 4 cut(s) 15, 100, 528, 539
BveI ACCTGC 1 cut(s) 388
Cac8I GCNNGC 2 cut(s) 57, 576
Cfr13I GGNCC 3 cut(s) 28, 229, 439
Csp6I GTAC 2 cut(s) 401, 484
CviAII CATG 3 cut(s) 334, 348, 480
CviJI RGCY 6 cut(s) 139, 230, 324, 332, 377, 416
CviKI_1 RGCY 6 cut(s) 139, 230, 324, 332, 377, 416
CviQI GTAC 2 cut(s) 401, 484
DdeI CTNAG 1 cut(s) 378
DpnI GATC 1 cut(s) 507
DpnII GATC 1 cut(s) 505
EaeI YGGCCR 1 cut(s) 322
Eam1104I CTCTTC 1 cut(s) 239
EarI CTCTTC 1 cut(s) 239
Eco47I GGWCC 2 cut(s) 28, 439
EcoO109I RGGNCCY 2 cut(s) 28, 229
FaeI CATG 3 cut(s) 337, 351, 483
FatI CATG 3 cut(s) 333, 347, 479
FbaI TGATCA 1 cut(s) 505
FokI GGATG 4 cut(s) 2, 107, 535, 546
HaeIII GGCC 3 cut(s) 230, 324, 332
HapII CCGG 1 cut(s) 325
Hin1II CATG 3 cut(s) 337, 351, 483
HinfI GANTC 3 cut(s) 11, 125, 308
HpaII CCGG 1 cut(s) 325
HphI GGTGA 1 cut(s) 484
Hpy166II GTNNAC 2 cut(s) 112, 422
Hpy188I TCNGA 2 cut(s) 292, 313
Hpy188III TCNNGA 3 cut(s) 145, 224, 509
Hpy8I GTNNAC 2 cut(s) 112, 422
HpyAV CCTTC 4 cut(s) 214, 448, 469, 532
HpyCH4III ACNGT 5 cut(s) 78, 103, 116, 287, 426
HpyCH4IV ACGT 1 cut(s) 403
HpyCH4V TGCA 1 cut(s) 578
HpyF10VI GCNNNNNNNGC 1 cut(s) 197
HpyF3I CTNAG 1 cut(s) 378
HpySE526I ACGT 1 cut(s) 403
Hsp92II CATG 3 cut(s) 337, 351, 483
KpnI GGTACC 1 cut(s) 487
Ksp22I TGATCA 1 cut(s) 505
Kzo9I GATC 1 cut(s) 505
LpnPI CCDG 6 cut(s) 77, 130, 171, 338, 383, 402
LweI GCATC 1 cut(s) 513
MaeII ACGT 1 cut(s) 403
MaeIII GTNAC 3 cut(s) 72, 211, 281
MalI GATC 1 cut(s) 507
MboI GATC 1 cut(s) 505
MboII GAAGA 2 cut(s) 226, 552
MfeI CAATTG 1 cut(s) 501
MluCI AATT 4 cut(s) 4, 64, 501, 546
MseI TTAA 3 cut(s) 81, 183, 270
MslI CAYNNNNRTG 1 cut(s) 338
MspI CCGG 1 cut(s) 325
MspR9I CCNGG 1 cut(s) 326
MunI CAATTG 1 cut(s) 501
MwoI GCNNNNNNNGC 1 cut(s) 197
NciI CCSGG 1 cut(s) 326
NdeII GATC 1 cut(s) 505
NlaIII CATG 3 cut(s) 337, 351, 483
NlaIV GGNNCC 3 cut(s) 190, 485, 573
NmuCI GTSAC 2 cut(s) 211, 281
NspI RCATGY 1 cut(s) 351
PfeI GAWTC 3 cut(s) 11, 125, 308
PpuMI RGGWCCY 1 cut(s) 28
Psp5II RGGWCCY 1 cut(s) 28
PspN4I GGNNCC 3 cut(s) 190, 485, 573
PspPI GGNCC 3 cut(s) 28, 229, 439
PspPPI RGGWCCY 1 cut(s) 28
RsaI GTAC 2 cut(s) 402, 485
RsaNI GTAC 2 cut(s) 401, 484
RseI CAYNNNNRTG 1 cut(s) 338
SaqAI TTAA 3 cut(s) 81, 183, 270
Sau3AI GATC 1 cut(s) 505
Sau96I GGNCC 3 cut(s) 28, 229, 439
ScrFI CCNGG 1 cut(s) 326
SfaNI GCATC 1 cut(s) 513
SinI GGWCC 2 cut(s) 28, 439
SmiMI CAYNNNNRTG 1 cut(s) 338
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
Sse9I AATT 4 cut(s) 4, 64, 501, 546
StyD4I CCNGG 1 cut(s) 324
TaaI ACNGT 5 cut(s) 78, 103, 116, 287, 426
TaiI ACGT 1 cut(s) 406
TaqI TCGA 2 cut(s) 217, 544
TasI AATT 4 cut(s) 4, 64, 501, 546
TfiI GAWTC 3 cut(s) 11, 125, 308
Tru1I TTAA 3 cut(s) 81, 183, 270
Tru9I TTAA 3 cut(s) 81, 183, 270
TseFI GTSAC 2 cut(s) 211, 281
Tsp45I GTSAC 2 cut(s) 211, 281
TspDTI ATGAA 2 cut(s) 161, 350
VpaK11BI GGWCC 2 cut(s) 28, 439
XceI RCATGY 1 cut(s) 351
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.