Rmu_co8279117.1_g000001

Reverse transcriptase (RNA-dependent DNA polymerase)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8279117.1
OG0000175
Physical Location & Seq
Reverse (-)
2 .. 824
823 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8279117.1_g000001.1.cds

Sequence Viewer

Length: 823 bp
atgacaattatgaaactagcagaaaaagcaacaagtcttcacattattgattttggtacttcttatggtttccaatggccctctctcatccaatgtctttcagagagacatggtggacctcctaagcttcgtatcactacaattgagcttccccaaccaggatttcgacccacagagagggttgaagaaactggtcgccgcttagcaaagtattctgcaagatttagtgtcccatttgagttccatgtcattgctcagaaatgggaaactgttggatttgatgatcttaagatcgacagaaatgagctgattgtggtcaactgtctacaccggttaaagcacgttcctgatgtgacaatgatggggaacagtccgagagatgctgtcctaaagttgatcaagaaaatcaatccagaaattttcattcatggggttgtcaatggggcatacaactcacccttctttctcacacgtttcaaacaggcactcttccactacgatgcactctttaatgtctttgagaccaccattccttgtgaggatcaacaacgactgtttttcgaaagagcaggatatggtagagacataatgaatgtagtggcgtgtgagggactggaaatagttgaaaggcctgagacatataagaagtggcaggtcaggactgtgagggctgggttcaagcagctcccattagaccaggagctgttgaagaaggtgaagactatgtcaaagtcgatgggttatcacaatgattttagtattgatgaagacgagcagtggatgctgcagggatggaaaggaagagtcctcatggctctttcct
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GRAS RVT_2

Protein Analysis

274

Amino Acids

31.77

Weight (kDa)

8.79

Isoelectric Point (pI)

39.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000175)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G46600 AT3G46600 AT3G46600 AT5G59450
fragaria_vesca FvH4_3g36690 FvH4_3g36690 FvH4_3g36690 FvH4_3g36690 FvH4_3g36690 FvH4_3g36690 FvH4_3g36691 FvH4_3g36700 FvH4_3g36711 FvH4_3g36711 FvH4_3g36720 FvH4_3g36730 FvH4_3g36760
malus_domestica MD03G1088900.v1.1 MD03G1089100.v1.1 MD03G1089200.v1.1 MD03G1089300.v1.1 MD11G1097900.v1.1 MD11G1098000.v1.1 MD11G1098100.v1.1 MD11G1098400.v1.1 MD11G1098900.v1.1
prunus_persica Prupe.6G073300_v2.0.a1 Prupe.6G073400_v2.0.a1 Prupe.6G073400_v2.0.a1 Prupe.6G073500_v2.0.a1 Prupe.6G073600_v2.0.a1 Prupe.6G073700_v2.0.a1 Prupe.6G073800_v2.0.a1 Prupe.I004400_v2.0.a1 Prupe.I004500_v2.0.a1
pyrus_communis pycom03g07050 pycom03g07060 pycom03g07070 pycom03g07110 pycom04g11870 pycom11g08270 pycom11g08280
rosa_chinensis RchiOBHm_Chr5g0065591 RchiOBHm_Chr5g0065601 RchiOBHm_Chr5g0065621 RchiOBHm_Chr5g0065631 RchiOBHm_Chr5g0065641 RchiOBHm_Chr5g0065651 RchiOBHm_Chr5g0065671 RchiOBHm_Chr5g0065721 RchiOBHm_Chr5g0065731 RchiOBHm_Chr5g0065751 RchiOBHm_Chr5g0065791 RchiOBHm_Chr5g0065811
rosa_laevigata RLG00000035800 RLG00000035801 RLG00000035803 RLG00000035804 RLG00000035805 RLG00000035806 RLG00000035807 RLG00000035808 RLG00000035809 RLG00000035810 RLG00000035813 RLG00000035814 RLG00000035816
rosa_multiflora Rmu_co8233911.1_g000001 Rmu_co8258053.1_g000001 Rmu_co8279117.1_g000001 Rmu_sc0000235.1_g000004 Rmu_sc0000235.1_g000024 Rmu_sc0000235.1_g000060 Rmu_sc0000235.1_g000074 Rmu_sc0001010.1_g000001 Rmu_sc0001010.1_g000015 Rmu_sc0001010.1_g000030 Rmu_sc0001010.1_g000037 Rmu_sc0001010.1_g000043 Rmu_sc0001010.1_g000063 Rmu_sc0001010.1_g000066 Rmu_sc0003636.1_g000008 Rmu_sc0003636.1_g000011 Rmu_sc0003636.1_g000012 Rmu_sc0003636.1_g000015 Rmu_sc0005971.1_g000017 Rmu_sc0008231.1_g000001 Rmu_sc0032155.1_g000001
rosa_roxburghii Rroxscaffold_1G00015360 Rroxscaffold_1G00015390 Rroxscaffold_1G00015410 Rroxscaffold_1G00015430 Rroxscaffold_1G00015490 Rroxscaffold_1G00015520 Rroxscaffold_1G00015530 Rroxscaffold_1G00015550 Rroxscaffold_1G00015560 Rroxscaffold_1G00015580 Rroxscaffold_1G00015600 Rroxscaffold_1G00015610 Rroxscaffold_1G00015620 Rroxscaffold_1G00015630
rosa_rugosa Rorug05G0372800 Rorug05G0372800 Rorug05G0372800 Rorug05G0372800 Rorug05G0373100 Rorug05G0373100 Rorug05G0373200 Rorug05G0373300 Rorug05G0373400 Rorug05G0373500 Rorug05G0373600 Rorug05G0373700 Rorug05G0378700
rosa_samantha Rh5AG430900 Rh5AG431000 Rh5AG431100 Rh5AG431200 Rh5AG431700 Rh5AG431800 Rh5AG431900 Rh5AG432200 Rh5AG432500 Rh5BG445200 Rh5BG446000 Rh5BG447100 Rh5BG447200 Rh5BG447400 Rh5BG447800 Rh5BG447900 Rh5BG448000 Rh5BG448100 Rh5BG448300 Rh5BG448400 Rh5BG448500 Rh5BG448600 Rh5CG467400 Rh5CG468000 Rh5CG469000 Rh5CG469100 Rh5CG469400 Rh5CG469700 Rh5CG469900 Rh5CG470100 Rh5CG470200 Rh5CG470600 Rh5CG470700 Rh5CG470800 Rh5DG459500 Rh5DG459700 Rh5DG459800 Rh5DG460000 Rh5DG460900 Rh5DG461300 Rh5DG461500 Rh5DG461900 Rh5DG462000 Rh5DG462100
rosa_wichuraiana Rw5G040420 Rw5G040430 Rw5G040440 Rw5G040470 Rw5G040480 Rw5G040500 Rw5G040510 Rw5G040530 Rw5G040550 Rw5G040560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 643
AccI GTMKAC 1 cut(s) 325
AciI CCGC 1 cut(s) 199
AclWI GGATC 1 cut(s) 549
AcsI RAATTY 1 cut(s) 417
AfaI GTAC 1 cut(s) 58
AfiI CCNNNNNNNGG 2 cut(s) 158, 177
AflII CTTAAG 1 cut(s) 287
AflIII ACRYGT 1 cut(s) 470
AgeI ACCGGT 1 cut(s) 330
AgsI TTSAA 5 cut(s) 185, 478, 626, 679, 709
AjnI CCWGG 2 cut(s) 157, 696
AjuI GAANNNNNNNTTGG 2 cut(s) 147, 179
AluBI AGCT 5 cut(s) 127, 148, 307, 685, 703
AluI AGCT 5 cut(s) 127, 148, 307, 685, 703
Alw26I GTCTC 4 cut(s) 100, 515, 576, 629
AlwI GGATC 1 cut(s) 549
AlwNI CAGNNNCTG 1 cut(s) 703
AoxI GGCC 2 cut(s) 77, 629
ApeKI GCWGC 2 cut(s) 682, 784
ApoI RAATTY 1 cut(s) 417
AsiGI ACCGGT 1 cut(s) 330
AspS9I GGNCC 2 cut(s) 78, 116
AsuHPI GGTGA 2 cut(s) 447, 727
AsuII TTCGAA 1 cut(s) 561
AvaII GGWCC 1 cut(s) 116
BbsI GAAGAC 3 cut(s) 29, 725, 774
BbvI GCAGC 2 cut(s) 694, 771
BccI CCATC 3 cut(s) 355, 730, 786
BciT130I CCWGG 2 cut(s) 159, 698
BclI TGATCA 1 cut(s) 396
BcoDI GTCTC 4 cut(s) 100, 515, 576, 629
BfaI CTAG 1 cut(s) 17
BfmI CTRYAG 1 cut(s) 785
BfrI CTTAAG 1 cut(s) 287
BfuAI ACCTGC 1 cut(s) 643
BisI GCNGC 3 cut(s) 199, 683, 785
BlpI GCTNAGC 1 cut(s) 202
BlsI GCNGC 3 cut(s) 200, 684, 786
Bme1390I CCNGG 2 cut(s) 159, 698
Bme18I GGWCC 1 cut(s) 116
BmgT120I GGNCC 2 cut(s) 78, 116
BmrFI CCNGG 2 cut(s) 159, 698
BmsI GCATC 3 cut(s) 370, 490, 771
BpiI GAAGAC 3 cut(s) 29, 725, 774
Bpu10I CCTNAGC 1 cut(s) 123
Bpu1102I GCTNAGC 1 cut(s) 202
Bpu14I TTCGAA 1 cut(s) 561
BsaI GGTCTC 1 cut(s) 515
BsaWI WCCGGW 1 cut(s) 330
Bsc4I CCNNNNNNNGG 2 cut(s) 158, 177
Bse118I RCCGGY 1 cut(s) 330
Bse1I ACTGG 2 cut(s) 196, 618
Bse3DI GCAATG 1 cut(s) 249
BseBI CCWGG 2 cut(s) 159, 698
BseGI GGATG 3 cut(s) 87, 786, 797
BseLI CCNNNNNNNGG 2 cut(s) 158, 177
BseMI GCAATG 1 cut(s) 249
BseMII CTCAG 2 cut(s) 269, 624
BseNI ACTGG 2 cut(s) 196, 618
BseXI GCAGC 2 cut(s) 694, 771
BseYI CCCAGC 1 cut(s) 671
BshFI GGCC 2 cut(s) 79, 631
BshTI ACCGGT 1 cut(s) 330
BsiSI CCGG 1 cut(s) 331
BslFI GGGAC 2 cut(s) 215, 624
BslI CCNNNNNNNGG 2 cut(s) 158, 177
BsmAI GTCTC 4 cut(s) 100, 515, 576, 629
BsmFI GGGAC 2 cut(s) 215, 624
BsnI GGCC 2 cut(s) 79, 631
Bso31I GGTCTC 1 cut(s) 515
Bsp119I TTCGAA 1 cut(s) 561
Bsp143I GATC 4 cut(s) 283, 291, 396, 541
Bsp1720I GCTNAGC 1 cut(s) 202
BspACI CCGC 1 cut(s) 199
BspANI GGCC 2 cut(s) 79, 631
BspCNI CTCAG 2 cut(s) 268, 625
BspMAI CTGCAG 1 cut(s) 789
BspMI ACCTGC 1 cut(s) 643
BspPI GGATC 1 cut(s) 549
BspT104I TTCGAA 1 cut(s) 561
BspTI CTTAAG 1 cut(s) 287
BspTNI GGTCTC 1 cut(s) 515
BsrDI GCAATG 1 cut(s) 249
BsrFI RCCGGY 1 cut(s) 330
BsrI ACTGG 2 cut(s) 196, 618
BssAI RCCGGY 1 cut(s) 330
BssMI GATC 4 cut(s) 283, 291, 396, 541
Bst2UI CCWGG 2 cut(s) 159, 698
Bst4CI ACNGT 5 cut(s) 271, 323, 371, 555, 664
Bst6I CTCTTC 2 cut(s) 494, 796
BstAFI CTTAAG 1 cut(s) 287
BstAPI GCANNNNNTGC 1 cut(s) 781
BstBI TTCGAA 1 cut(s) 561
BstDEI CTNAG 4 cut(s) 123, 202, 255, 633
BstF5I GGATG 3 cut(s) 87, 786, 797
BstKTI GATC 4 cut(s) 286, 294, 399, 544
BstMAI GTCTC 4 cut(s) 100, 515, 576, 629
BstMBI GATC 4 cut(s) 283, 291, 396, 541
BstMWI GCNNNNNNNGC 2 cut(s) 26, 781
BstNI CCWGG 2 cut(s) 159, 698
BstSCI CCNGG 2 cut(s) 157, 696
BstSFI CTRYAG 1 cut(s) 785
BstV1I GCAGC 2 cut(s) 694, 771
BstV2I GAAGAC 3 cut(s) 29, 725, 774
BsuRI GGCC 2 cut(s) 79, 631
BtsCI GGATG 3 cut(s) 87, 786, 797
BtsI GCAGTG 1 cut(s) 782
BtsIMutI CAGTG 1 cut(s) 782
BveI ACCTGC 1 cut(s) 643
CaiI CAGNNNCTG 1 cut(s) 703
Cfr10I RCCGGY 1 cut(s) 330
Cfr13I GGNCC 2 cut(s) 78, 116
Csp6I GTAC 1 cut(s) 57
CspAI ACCGGT 1 cut(s) 330
CviAII CATG 4 cut(s) 110, 245, 428, 811
CviJI RGCY 9 cut(s) 79, 127, 148, 307, 631, 671, 685, 703, 815
CviKI_1 RGCY 9 cut(s) 79, 127, 148, 307, 631, 671, 685, 703, 815
CviQI GTAC 1 cut(s) 57
DdeI CTNAG 4 cut(s) 123, 202, 255, 633
DpnI GATC 4 cut(s) 285, 293, 398, 543
DpnII GATC 4 cut(s) 283, 291, 396, 541
Eam1104I CTCTTC 2 cut(s) 494, 796
EarI CTCTTC 2 cut(s) 494, 796
Eco147I AGGCCT 1 cut(s) 631
Eco31I GGTCTC 1 cut(s) 515
Eco47I GGWCC 1 cut(s) 116
EcoRII CCWGG 2 cut(s) 157, 696
FaeI CATG 4 cut(s) 113, 248, 431, 814
FaqI GGGAC 2 cut(s) 215, 624
FatI CATG 4 cut(s) 109, 244, 427, 810
FbaI TGATCA 1 cut(s) 396
FblI GTMKAC 1 cut(s) 325
Fnu4HI GCNGC 3 cut(s) 199, 683, 785
FokI GGATG 3 cut(s) 74, 793, 804
Fsp4HI GCNGC 3 cut(s) 199, 683, 785
FspBI CTAG 1 cut(s) 17
GluI GCNGC 3 cut(s) 199, 683, 785
GsaI CCCAGC 1 cut(s) 675
HaeIII GGCC 2 cut(s) 79, 631
HapII CCGG 1 cut(s) 331
Hin1II CATG 4 cut(s) 113, 248, 431, 814
HincII GTYRAC 1 cut(s) 319
HindII GTYRAC 1 cut(s) 319
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 1 cut(s) 804
HpaII CCGG 1 cut(s) 331
HphI GGTGA 2 cut(s) 447, 727
Hpy166II GTNNAC 3 cut(s) 116, 319, 326
Hpy188I TCNGA 3 cut(s) 103, 258, 375
Hpy188III TCNNGA 4 cut(s) 347, 400, 413, 658
Hpy8I GTNNAC 3 cut(s) 116, 319, 326
HpyAV CCTTC 2 cut(s) 469, 706
HpyCH4III ACNGT 5 cut(s) 271, 323, 371, 555, 664
HpyCH4IV ACGT 2 cut(s) 342, 472
HpyCH4V TGCA 3 cut(s) 218, 503, 787
HpyF10VI GCNNNNNNNGC 2 cut(s) 26, 781
HpyF3I CTNAG 4 cut(s) 123, 202, 255, 633
HpySE526I ACGT 2 cut(s) 342, 472
Hsp92II CATG 4 cut(s) 113, 248, 431, 814
Ksp22I TGATCA 1 cut(s) 396
Kzo9I GATC 4 cut(s) 283, 291, 396, 541
LmnI GCTCC 2 cut(s) 690, 700
Lsp1109I GCAGC 2 cut(s) 694, 771
LweI GCATC 3 cut(s) 370, 490, 771
MaeI CTAG 1 cut(s) 17
MaeII ACGT 2 cut(s) 342, 472
MaeIII GTNAC 1 cut(s) 352
MalI GATC 4 cut(s) 285, 293, 398, 543
MboI GATC 4 cut(s) 283, 291, 396, 541
MboII GAAGA 7 cut(s) 29, 197, 481, 721, 730, 779, 813
MfeI CAATTG 1 cut(s) 141
MluCI AATT 3 cut(s) 6, 141, 417
MlyI GAGTC 1 cut(s) 813
MmeI TCCRAC 1 cut(s) 253
MnlI CCTC 7 cut(s) 91, 129, 171, 532, 601, 660, 818
MseI TTAA 3 cut(s) 288, 335, 510
MslI CAYNNNNRTG 1 cut(s) 498
MspCI CTTAAG 1 cut(s) 287
MspI CCGG 1 cut(s) 331
MspR9I CCNGG 2 cut(s) 159, 698
MunI CAATTG 1 cut(s) 141
MvaI CCWGG 2 cut(s) 159, 698
MwoI GCNNNNNNNGC 2 cut(s) 26, 781
NdeII GATC 4 cut(s) 283, 291, 396, 541
NlaIII CATG 4 cut(s) 113, 248, 431, 814
NmuCI GTSAC 1 cut(s) 352
NspV TTCGAA 1 cut(s) 561
PceI AGGCCT 1 cut(s) 631
PflFI GACNNNGTC 1 cut(s) 724
PinAI ACCGGT 1 cut(s) 330
PkrI GCNGC 3 cut(s) 200, 684, 786
PleI GAGTC 1 cut(s) 812
PpsI GAGTC 1 cut(s) 812
Psp6I CCWGG 2 cut(s) 157, 696
PspFI CCCAGC 1 cut(s) 671
PspGI CCWGG 2 cut(s) 157, 696
PspPI GGNCC 2 cut(s) 78, 116
PstI CTGCAG 1 cut(s) 789
PstNI CAGNNNCTG 1 cut(s) 703
PsyI GACNNNGTC 1 cut(s) 724
RsaI GTAC 1 cut(s) 58
RsaNI GTAC 1 cut(s) 57
RseI CAYNNNNRTG 1 cut(s) 498
SaqAI TTAA 3 cut(s) 288, 335, 510
SatI GCNGC 3 cut(s) 199, 683, 785
Sau3AI GATC 4 cut(s) 283, 291, 396, 541
Sau96I GGNCC 2 cut(s) 78, 116
SchI GAGTC 1 cut(s) 813
ScrFI CCNGG 2 cut(s) 159, 698
SfaNI GCATC 3 cut(s) 370, 490, 771
SfcI CTRYAG 1 cut(s) 785
SfuI TTCGAA 1 cut(s) 561
SinI GGWCC 1 cut(s) 116
SmiMI CAYNNNNRTG 1 cut(s) 498
SmlI CTYRAG 1 cut(s) 287
SmoI CTYRAG 1 cut(s) 287
Sse9I AATT 3 cut(s) 6, 141, 417
SseBI AGGCCT 1 cut(s) 631
SsiI CCGC 1 cut(s) 199
SspMI CTAG 1 cut(s) 17
StuI AGGCCT 1 cut(s) 631
StyD4I CCNGG 2 cut(s) 157, 696
TaaI ACNGT 5 cut(s) 271, 323, 371, 555, 664
TaiI ACGT 2 cut(s) 345, 475
TaqI TCGA 4 cut(s) 166, 294, 561, 734
TasI AATT 3 cut(s) 6, 141, 417
TauI GCSGC 1 cut(s) 201
Tru1I TTAA 3 cut(s) 288, 335, 510
Tru9I TTAA 3 cut(s) 288, 335, 510
TscAI CASTG 1 cut(s) 782
TseFI GTSAC 1 cut(s) 352
TseI GCWGC 2 cut(s) 682, 784
Tsp45I GTSAC 1 cut(s) 352
TspDTI ATGAA 5 cut(s) 26, 412, 416, 605, 780
TspRI CASTG 1 cut(s) 782
Tth111I GACNNNGTC 1 cut(s) 724
Vha464I CTTAAG 1 cut(s) 287
VpaK11BI GGWCC 1 cut(s) 116
XapI RAATTY 1 cut(s) 417
XmiI GTMKAC 1 cut(s) 325
XspI CTAG 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.