Rh1CG000600

G-type lectin S-receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0000130
Physical Location & Seq
Forward (+)
49188 .. 49454
267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG000600.1

Sequence Viewer

Length: 267 bp
ATGGAAAAGGAAAATGAAGAAGAAGTGATACTAACTGACTGGGTTTACGATTGCTACAAGCATAGGAGATTAAACAAGGTGATTGAGGACGATGAGGAGGCAGGAAATGACATGAAAAGGCTGGAGAGGCTAGTAATGGTGGCAATTTGGTGCATACAAGAGGATCCATCTTTGAGACCCACCATGAAGAAGGTTACACAAATGCTCGAAGGAGTGGTTGATGTATCTGTACCTCCAAGTCCTTCTCTTTTTAGTTCAATATGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B_lectin PAN_2 Pkinase S_locus_glycop

Protein Analysis

88

Amino Acids

10.26

Weight (kDa)

4.61

Isoelectric Point (pI)

64.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000130)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g43780
malus_domestica MD03G1019500.v1.1 MD03G1019800.v1.1 MD03G1019900.v1.1 MD03G1020000.v1.1 MD03G1020200.v1.1 MD03G1020300.v1.1 MD05G1226500.v1.1 MD05G1226600.v1.1 MD05G1226700.v1.1 MD05G1226800.v1.1 MD09G1060200.v1.1 MD11G1021100.v1.1 MD11G1021300.v1.1 MD11G1021400.v1.1 MD11G1021500.v1.1 MD11G1024600.v1.1 MD11G1026700.v1.1
prunus_persica Prupe.6G016300_v2.0.a1 Prupe.6G016600_v2.0.a1 Prupe.6G016700_v2.0.a1 Prupe.6G017000_v2.0.a1 Prupe.6G017100_v2.0.a1 Prupe.6G017200_v2.0.a1 Prupe.6G017300_v2.0.a1 Prupe.6G017400_v2.0.a1 Prupe.6G017500_v2.0.a1
pyrus_communis pycom02g26630 pycom03g01670 pycom03g01710 pycom03g01720 pycom05g20850 pycom11g01710 pycom11g01730 pycom11g01740 pycom11g01960
rosa_chinensis RchiOBHm_Chr1g0313471 RchiOBHm_Chr1g0313491 RchiOBHm_Chr1g0313521 RchiOBHm_Chr1g0329041 RchiOBHm_Chr5g0077581 RchiOBHm_Chr5g0077681 RchiOBHm_Chr5g0077751 RchiOBHm_Chr5g0077771 RchiOBHm_Chr5g0078381 RchiOBHm_Chr5g0078421 RchiOBHm_Chr5g0078481 RchiOBHm_Chr5g0078491 RchiOBHm_Chr5g0078511 RchiOBHm_Chr5g0078561 RchiOBHm_Chr5g0078581 RchiOBHm_Chr5g0078621 RchiOBHm_Chr5g0078631 RchiOBHm_Chr5g0078641 RchiOBHm_Chr5g0078681 RchiOBHm_Chr5g0078741 RchiOBHm_Chr5g0078781 RchiOBHm_Chr5g0078791 RchiOBHm_Chr5g0078821 RchiOBHm_Chr5g0078851 RchiOBHm_Chr5g0078861 RchiOBHm_Chr5g0078881 RchiOBHm_Chr5g0078911 RchiOBHm_Chr5g0078921 RchiOBHm_Chr5g0078931 RchiOBHm_Chr5g0078951 RchiOBHm_Chr5g0079061 RchiOBHm_Chr5g0079071 RchiOBHm_Chr5g0079101 RchiOBHm_Chr5g0079111 RchiOBHm_Chr5g0079131 RchiOBHm_Chr5g0079151 RchiOBHm_Chr5g0079161 RchiOBHm_Chr5g0079211 RchiOBHm_Chr5g0079241 RchiOBHm_Chr7g0223671
rosa_laevigata RLG00000001266 RLG00000036708 RLG00000036719 RLG00000036772 RLG00000036773 RLG00000036776 RLG00000036780 RLG00000036781 RLG00000036783 RLG00000036788 RLG00000036790 RLG00000036792 RLG00000036794 RLG00000036797 RLG00000036798 RLG00000036800 RLG00000036801 RLG00000036802 RLG00000036803 RLG00000036805 RLG00000036807 RLG00000036808
rosa_multiflora Rmu_co7998958.1_g000001 Rmu_co8175864.1_g000001 Rmu_co8214884.1_g000001 Rmu_co8225446.1_g000001 Rmu_sc0000607.1_g000011 Rmu_sc0000607.1_g000012 Rmu_sc0000631.1_g000001 Rmu_sc0000631.1_g000003 Rmu_sc0000631.1_g000010 Rmu_sc0000631.1_g000012 Rmu_sc0000631.1_g000020 Rmu_sc0001347.1_g000014 Rmu_sc0002187.1_g000011 Rmu_sc0002187.1_g000014 Rmu_sc0002187.1_g000024 Rmu_sc0002187.1_g000025 Rmu_sc0003413.1_g000051 Rmu_sc0004140.1_g000002 Rmu_sc0004140.1_g000003 Rmu_sc0004140.1_g000015 Rmu_sc0004140.1_g000026 Rmu_sc0004140.1_g000036 Rmu_sc0004140.1_g000042 Rmu_sc0004140.1_g000046 Rmu_sc0004140.1_g000048 Rmu_sc0004277.1_g000002 Rmu_sc0008700.1_g000002 Rmu_sc0011280.1_g000001 Rmu_sc0011280.1_g000002 Rmu_sc0011280.1_g000009 Rmu_sc0012487.1_g000003 Rmu_sc0012487.1_g000007 Rmu_sc0012487.1_g000009 Rmu_sc0012931.1_g000001 Rmu_sc0012931.1_g000002 Rmu_sc0012931.1_g000009 Rmu_sc0015122.1_g000002 Rmu_sc0022488.1_g000001 Rmu_ssc0000425.1_g000018
rosa_roxburghii Rroxscaffold_164G00436380 Rroxscaffold_1G00003360 Rroxscaffold_1G00003370 Rroxscaffold_1G00003660 Rroxscaffold_1G00003790 Rroxscaffold_1G00003840 Rroxscaffold_1G00003950 Rroxscaffold_1G00004380 Rroxscaffold_4G00332170
rosa_rugosa Rorug05G0455800 Rorug05G0456500 Rorug05G0460800 Rorug05G0461000 Rorug05G0461200 Rorug05G0461200 Rorug05G0461300 Rorug05G0461600 Rorug05G0461700 Rorug05G0461900 Rorug05G0462000 Rorug05G0462400 Rorug05G0462500 Rorug05G0462800 Rorug05G0463200.1 Rorug05G0463300
rosa_samantha Rh1CG000600 Rh1CG008300 Rh1CG360600 Rh5AG509700 Rh5AG509800 Rh5AG510700 Rh5AG515000 Rh5AG515600 Rh5BG531300 Rh5BG531400 Rh5BG533600 Rh5BG538200 Rh5BG538300 Rh5BG538400 Rh5BG538500 Rh5BG539100 Rh5BG539200 Rh5BG539400 Rh5DG545100 Rh5DG549000 Rh5DG549200 Rh5DG549500 Rh5DG549600 Rh5DG549800 Rh5DG549900 Rh5DG550000 Rh5DG550200 Rh5DG550300 Rh7AG436900 Rh7CG456800
rosa_wichuraiana Rw0G003110 Rw0G003120 Rw0G005240 Rw0G023800 Rw0G023830 Rw1G007840 Rw5G000030 Rw5G047760 Rw5G047780 Rw5G047810 Rw5G047900 Rw5G047920 Rw5G047970 Rw5G047980 Rw5G048000 Rw5G048010 Rw5G048030

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 158, 171
AfaI GTAC 1 cut(s) 231
AgsI TTSAA 1 cut(s) 258
Alw26I GTCTC 1 cut(s) 169
AlwI GGATC 2 cut(s) 158, 171
AsuHPI GGTGA 1 cut(s) 91
BamHI GGATCC 1 cut(s) 163
BarI GAAGNNNNNNTAC 2 cut(s) 12, 44
BccI CCATC 1 cut(s) 175
BcoDI GTCTC 1 cut(s) 169
BfaI CTAG 1 cut(s) 131
BmiI GGNNCC 1 cut(s) 165
BmrI ACTGGG 1 cut(s) 49
BmuI ACTGGG 1 cut(s) 49
BpmI CTGGAG 1 cut(s) 143
BsaI GGTCTC 1 cut(s) 169
Bse1I ACTGG 1 cut(s) 44
BseNI ACTGG 1 cut(s) 44
BseRI GAGGAG 1 cut(s) 110
BsmAI GTCTC 1 cut(s) 169
Bso31I GGTCTC 1 cut(s) 169
Bsp143I GATC 1 cut(s) 163
BspLI GGNNCC 1 cut(s) 165
BspPI GGATC 2 cut(s) 158, 171
BspTNI GGTCTC 1 cut(s) 169
BsrI ACTGG 1 cut(s) 44
BssMI GATC 1 cut(s) 163
BstKTI GATC 1 cut(s) 166
BstMAI GTCTC 1 cut(s) 169
BstMBI GATC 1 cut(s) 163
BstMWI GCNNNNNNNGC 1 cut(s) 127
BstX2I RGATCY 1 cut(s) 163
BstYI RGATCY 1 cut(s) 163
Csp6I GTAC 1 cut(s) 230
CviAII CATG 2 cut(s) 112, 184
CviJI RGCY 2 cut(s) 121, 130
CviKI_1 RGCY 2 cut(s) 121, 130
CviQI GTAC 1 cut(s) 230
DpnI GATC 1 cut(s) 165
DpnII GATC 1 cut(s) 163
Eco31I GGTCTC 1 cut(s) 169
FaeI CATG 2 cut(s) 115, 187
FaiI YATR 5 cut(s) 63, 113, 155, 185, 262
FatI CATG 2 cut(s) 111, 183
FspBI CTAG 1 cut(s) 131
GsuI CTGGAG 1 cut(s) 143
Hin1II CATG 2 cut(s) 115, 187
HphI GGTGA 1 cut(s) 91
Hpy166II GTNNAC 1 cut(s) 46
Hpy8I GTNNAC 1 cut(s) 46
HpyAV CCTTC 3 cut(s) 184, 203, 252
HpyCH4V TGCA 1 cut(s) 153
HpyF10VI GCNNNNNNNGC 1 cut(s) 127
Hsp92II CATG 2 cut(s) 115, 187
Kzo9I GATC 1 cut(s) 163
LpnPI CCDG 3 cut(s) 25, 87, 107
MaeI CTAG 1 cut(s) 131
MaeIII GTNAC 1 cut(s) 193
MalI GATC 1 cut(s) 165
MboI GATC 1 cut(s) 163
MboII GAAGA 3 cut(s) 29, 32, 199
MflI RGATCY 1 cut(s) 163
MluCI AATT 1 cut(s) 144
MnlI CCTC 6 cut(s) 79, 88, 91, 120, 154, 243
MseI TTAA 1 cut(s) 71
MwoI GCNNNNNNNGC 1 cut(s) 127
NdeII GATC 1 cut(s) 163
NlaIII CATG 2 cut(s) 115, 187
NlaIV GGNNCC 1 cut(s) 165
PspN4I GGNNCC 1 cut(s) 165
PsuI RGATCY 1 cut(s) 163
RsaI GTAC 1 cut(s) 231
RsaNI GTAC 1 cut(s) 230
SaqAI TTAA 1 cut(s) 71
Sau3AI GATC 1 cut(s) 163
SetI ASST 3 cut(s) 81, 195, 235
Sse9I AATT 1 cut(s) 144
SspMI CTAG 1 cut(s) 131
TaqI TCGA 1 cut(s) 207
TasI AATT 1 cut(s) 144
Tru1I TTAA 1 cut(s) 71
Tru9I TTAA 1 cut(s) 71
TspDTI ATGAA 3 cut(s) 30, 128, 200
XspI CTAG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.