Rmu_co8138284.1_g000001

Mediator of RNA polymerase II transcription subunit 15a-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8138284.1
OG0000315
Physical Location & Seq
Reverse (-)
160 .. 570
411 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8138284.1_g000001.1.cds

Sequence Viewer

Length: 411 bp
atgtcggactcatcttccgctttacctcctgccttcagtctagacttattgactaattatcataggcaaatgcaaggacagcaacaggtagttcctcaacagcaacagcagcaatcaaagtattcacagcagcggatttctcagcaacagatacaacaagaacttatccgaaatatccaacagcaacaagagcagcagcagatgctattacaaaaaacaccattgtcatcttctcagcaatctcatgtacaatcagcatctgctgcagtggaatcttttctctgtaggcttcagcagaatcaacaattagctatttcccagttgacacaacccatgcttcagcaaacagcaatgccacaacagcaaatattgccgccacagcatcaacagcaacagttaacaggtttataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KIX_2

Protein Analysis

136

Amino Acids

15.59

Weight (kDa)

7.98

Isoelectric Point (pI)

104.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000315)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G15790 AT1G15790 AT1G15790 AT1G15790 AT1G15790
fragaria_vesca FvH4_3g12350 FvH4_3g37483 FvH4_3g42320 FvH4_3g42330 FvH4_3g42330 FvH4_3g42330 FvH4_3g42330 FvH4_3g42330 FvH4_3g42361
malus_domestica MD03G1031600.v1.1 MD03G1031700.v1.1 MD03G1033500.v1.1 MD07G1261500.v1.1 MD11G1035800.v1.1
prunus_persica Prupe.6G027700_v2.0.a1 Prupe.6G027700_v2.0.a1 Prupe.6G027700_v2.0.a1 Prupe.6G027700_v2.0.a1 Prupe.6G027700_v2.0.a1 Prupe.6G027700_v2.0.a1 Prupe.6G027700_v2.0.a1
pyrus_communis pycom03g02570 pycom03g02580
rosa_chinensis RchiOBHm_Chr4g0419101 RchiOBHm_Chr5g0075711 RchiOBHm_Chr5g0075731 RchiOBHm_Chr5g0075781 RchiOBHm_Chr5g0075801 RchiOBHm_Chr5g0075811 RchiOBHm_Chr5g0075831 RchiOBHm_Chr5g0075841 RchiOBHm_Chr5g0075851 RchiOBHm_Chr5g0075861
rosa_laevigata RLG00000029834 RLG00000036588 RLG00000036591 RLG00000036592 RLG00000036594 RLG00000036595 RLG00000036597 RLG00000036647
rosa_multiflora Rmu_co8127406.1_g000001 Rmu_co8138284.1_g000001 Rmu_sc0002101.1_g000001 Rmu_sc0002101.1_g000006 Rmu_sc0002652.1_g000027 Rmu_sc0002652.1_g000029 Rmu_sc0008562.1_g000002 Rmu_sc0019599.1_g000001 Rmu_sc0019861.1_g000005 Rmu_sc0029317.1_g000001 Rmu_sc0031378.1_g000001 Rmu_ssc0000402.1_g000001
rosa_roxburghii Rroxscaffold_1G00005820 Rroxscaffold_1G00005830 Rroxscaffold_1G00005840 Rroxscaffold_1G00005850 Rroxscaffold_1G00005860 Rroxscaffold_1G00005870 Rroxscaffold_1G00005890 Rroxscaffold_5G00340930 Rroxscaffold_5G00343250 Rroxscaffold_5G00369260
rosa_rugosa Rorug05G0442200 Rorug05G0442300.1 Rorug05G0442400 Rorug05G0442500 Rorug05G0442600 Rorug05G0442700 Rorug05G0442900
rosa_samantha Rh1AG189900 Rh2DG257500 Rh5AG498900 Rh5AG499100 Rh5AG499400 Rh5AG499500 Rh5AG499600 Rh5AG499700 Rh5AG499900 Rh5AG506800 Rh5BG519900 Rh5BG520100 Rh5BG520400 Rh5BG520500 Rh5BG520600 Rh5BG520800 Rh5BG520900 Rh5BG521100 Rh5CG543900 Rh5CG544100 Rh5CG544400 Rh5CG544500 Rh5CG544600 Rh5CG544800 Rh5CG544900 Rh5CG545000 Rh5CG545200 Rh5DG532700 Rh5DG533100 Rh5DG533200 Rh5DG533400 Rh5DG533500 Rh5DG533600 Rh5DG533700
rosa_wichuraiana Rw5G046310 Rw5G046340 Rw5G046350 Rw5G046360 Rw5G046370 Rw5G046380 Rw5G046400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 409
AciI CCGC 3 cut(s) 18, 133, 374
AcuI CTGAAG 3 cut(s) 19, 275, 323
AfaI GTAC 1 cut(s) 249
AluBI AGCT 1 cut(s) 311
AluI AGCT 1 cut(s) 311
AlwNI CAGNNNCTG 1 cut(s) 260
ApeKI GCWGC 5 cut(s) 109, 130, 193, 196, 263
Asp700I GAANNNNTTC 1 cut(s) 276
BbvI GCAGC 5 cut(s) 121, 142, 205, 208, 250
BfaI CTAG 1 cut(s) 41
BfmI CTRYAG 2 cut(s) 264, 283
BisI GCNGC 6 cut(s) 110, 131, 194, 197, 264, 374
BlsI GCNGC 6 cut(s) 111, 132, 195, 198, 265, 375
BmrI ACTGGG 1 cut(s) 313
BmsI GCATC 3 cut(s) 192, 266, 391
BmuI ACTGGG 1 cut(s) 313
Bse1I ACTGG 1 cut(s) 319
Bse3DI GCAATG 1 cut(s) 357
BseMI GCAATG 1 cut(s) 357
BseMII CTCAG 2 cut(s) 155, 248
BseNI ACTGG 1 cut(s) 319
BseXI GCAGC 5 cut(s) 121, 142, 205, 208, 250
Bsp1407I TGTACA 1 cut(s) 247
BspACI CCGC 3 cut(s) 18, 133, 374
BspCNI CTCAG 2 cut(s) 154, 247
BspMAI CTGCAG 1 cut(s) 268
BsrDI GCAATG 1 cut(s) 357
BsrGI TGTACA 1 cut(s) 247
BsrI ACTGG 1 cut(s) 319
Bst4CI ACNGT 1 cut(s) 396
BstAPI GCANNNNNTGC 3 cut(s) 202, 263, 370
BstAUI TGTACA 1 cut(s) 247
BstDEI CTNAG 2 cut(s) 141, 234
BstMWI GCNNNNNNNGC 9 cut(s) 79, 109, 190, 202, 263, 361, 370, 379, 388
BstSFI CTRYAG 2 cut(s) 264, 283
BstV1I GCAGC 5 cut(s) 121, 142, 205, 208, 250
BtsI GCAGTG 1 cut(s) 273
BtsIMutI CAGTG 1 cut(s) 273
CaiI CAGNNNCTG 1 cut(s) 260
Csp6I GTAC 1 cut(s) 248
CviAII CATG 2 cut(s) 245, 334
CviJI RGCY 2 cut(s) 289, 311
CviKI_1 RGCY 2 cut(s) 289, 311
CviQI GTAC 1 cut(s) 248
DdeI CTNAG 2 cut(s) 141, 234
Eco57I CTGAAG 3 cut(s) 19, 275, 323
FaeI CATG 2 cut(s) 248, 337
FaiI YATR 4 cut(s) 63, 246, 335, 409
FatI CATG 2 cut(s) 244, 333
Fnu4HI GCNGC 6 cut(s) 110, 131, 194, 197, 264, 374
Fsp4HI GCNGC 6 cut(s) 110, 131, 194, 197, 264, 374
FspBI CTAG 1 cut(s) 41
GluI GCNGC 6 cut(s) 110, 131, 194, 197, 264, 374
Hin1II CATG 2 cut(s) 248, 337
HincII GTYRAC 2 cut(s) 324, 399
HindII GTYRAC 2 cut(s) 324, 399
HinfI GANTC 3 cut(s) 8, 272, 298
HpaI GTTAAC 1 cut(s) 399
Hpy166II GTNNAC 2 cut(s) 324, 399
Hpy188I TCNGA 2 cut(s) 7, 170
Hpy188III TCNNGA 1 cut(s) 41
Hpy8I GTNNAC 2 cut(s) 324, 399
HpyAV CCTTC 1 cut(s) 43
HpyCH4III ACNGT 1 cut(s) 396
HpyCH4V TGCA 2 cut(s) 73, 266
HpyF10VI GCNNNNNNNGC 9 cut(s) 79, 109, 190, 202, 263, 361, 370, 379, 388
HpyF3I CTNAG 2 cut(s) 141, 234
Hsp92II CATG 2 cut(s) 248, 337
KspAI GTTAAC 1 cut(s) 399
LpnPI CCDG 4 cut(s) 42, 71, 332, 387
Lsp1109I GCAGC 5 cut(s) 121, 142, 205, 208, 250
LweI GCATC 3 cut(s) 192, 266, 391
MaeI CTAG 1 cut(s) 41
MboII GAAGA 2 cut(s) 6, 222
MluCI AATT 2 cut(s) 55, 305
MlyI GAGTC 1 cut(s) 2
MmeI TCCRAC 1 cut(s) 202
MnlI CCTC 2 cut(s) 36, 105
MroXI GAANNNNTTC 1 cut(s) 276
MseI TTAA 1 cut(s) 398
MspA1I CMGCKG 1 cut(s) 133
MwoI GCNNNNNNNGC 9 cut(s) 79, 109, 190, 202, 263, 361, 370, 379, 388
NlaIII CATG 2 cut(s) 248, 337
PdmI GAANNNNTTC 1 cut(s) 276
PfeI GAWTC 2 cut(s) 272, 298
PkrI GCNGC 6 cut(s) 111, 132, 195, 198, 265, 375
PleI GAGTC 1 cut(s) 2
PpsI GAGTC 1 cut(s) 2
PsiI TTATAA 1 cut(s) 409
PstI CTGCAG 1 cut(s) 268
PstNI CAGNNNCTG 1 cut(s) 260
RsaI GTAC 1 cut(s) 249
RsaNI GTAC 1 cut(s) 248
SaqAI TTAA 1 cut(s) 398
SatI GCNGC 6 cut(s) 110, 131, 194, 197, 264, 374
SchI GAGTC 1 cut(s) 2
SetI ASST 4 cut(s) 28, 90, 313, 406
SfaNI GCATC 3 cut(s) 192, 266, 391
SfcI CTRYAG 2 cut(s) 264, 283
SgeI CNNG 9 cut(s) 41, 53, 86, 98, 170, 200, 257, 331, 346
Sse9I AATT 2 cut(s) 55, 305
SsiI CCGC 3 cut(s) 18, 133, 374
SspI AATATT 1 cut(s) 369
SspMI CTAG 1 cut(s) 41
TaaI ACNGT 1 cut(s) 396
TasI AATT 2 cut(s) 55, 305
TatI WGTACW 1 cut(s) 247
TauI GCSGC 1 cut(s) 376
TfiI GAWTC 2 cut(s) 272, 298
Tru1I TTAA 1 cut(s) 398
Tru9I TTAA 1 cut(s) 398
TscAI CASTG 1 cut(s) 273
TseI GCWGC 5 cut(s) 109, 130, 193, 196, 263
TspRI CASTG 1 cut(s) 273
XbaI TCTAGA 1 cut(s) 40
XmnI GAANNNNTTC 1 cut(s) 276
XspI CTAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.