Rmu_ssc0000402.1_g000001

Mediator of RNA polymerase II transcription subunit 15a-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000402.1
OG0000315
Physical Location & Seq
Forward (+)
1 .. 1922
1922 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000402.1_g000001.1.cds

Sequence Viewer

Length: 1191 bp
gtaccacagaacatacagaataacattctgcctgctggagttcaaagttatactgggttgtcatctggactttctcctaccataaactatcaaacaagggaacaatttgtaccgcaaaatattcagaatagcattctgactgctggagttcaaagttctgttggcttatcatctgcactatctcctaccggaaactatcatccgtattgcctccaaccccctgcccctggtcaaaatattcccggcttatcatatgcactgcctcctccacagggtctgaatatgtctgcactagttgcctctattccgtctggcttttcttctgctccagcatctattatgcgaccttccacactgcagtcatctctccctaggcttcagcagaatcaacaatcaactattccccactcttcacaatccatgcttcagcaaacagcagtgccacaacagcaaatgttgccccaacagcttcaacagcaacagttagcagggtcttcaacagctcagcagaacaagaagactccattgcagacgattggagagctgttagccacaataaagaactcacagcagcaggtccctatgggctctattcaacagactccggtcagtgctccccagcaagctaacatgaatgtacagagtgggattaacacattgcacccaaacgttattccactcgatattcttcagaaccaacaacaatatcagaatcaacttcagcaacaatatcaaatccagctactacatcaacagcgtcaacagctgcagttgatgcagatgcagcagataaatcaacaactgcaacagcagctggctagacagtcgcagacacaccaaatgccacagcttcaccaaatcagagttgttgacgcgaacatgaatgcctcgtcatcacagagtgggagtaatatgctgcaggcaaacattgtttctcctctgccaaactctggtattgttgataaccagcatctgaagcaagaacaggagcagaaaatgtttaagcatcaaccccagcaaccatatcaacagctacagatgcagaagccgcagatgcttcaagaaaagcaacagcaaaagatacagcaactagagcaacaagcaaagcagcagctgtgtcatatttatttcatttatctcatctttctcaccattctgatgggtgctctaatcttcgggataggccattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KIX_2

Protein Analysis

396

Amino Acids

44.08

Weight (kDa)

9.46

Isoelectric Point (pI)

83.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000315)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G15790 AT1G15790 AT1G15790 AT1G15790 AT1G15790
fragaria_vesca FvH4_3g12350 FvH4_3g37483 FvH4_3g42320 FvH4_3g42330 FvH4_3g42330 FvH4_3g42330 FvH4_3g42330 FvH4_3g42330 FvH4_3g42361
malus_domestica MD03G1031600.v1.1 MD03G1031700.v1.1 MD03G1033500.v1.1 MD07G1261500.v1.1 MD11G1035800.v1.1
prunus_persica Prupe.6G027700_v2.0.a1 Prupe.6G027700_v2.0.a1 Prupe.6G027700_v2.0.a1 Prupe.6G027700_v2.0.a1 Prupe.6G027700_v2.0.a1 Prupe.6G027700_v2.0.a1 Prupe.6G027700_v2.0.a1
pyrus_communis pycom03g02570 pycom03g02580
rosa_chinensis RchiOBHm_Chr4g0419101 RchiOBHm_Chr5g0075711 RchiOBHm_Chr5g0075731 RchiOBHm_Chr5g0075781 RchiOBHm_Chr5g0075801 RchiOBHm_Chr5g0075811 RchiOBHm_Chr5g0075831 RchiOBHm_Chr5g0075841 RchiOBHm_Chr5g0075851 RchiOBHm_Chr5g0075861
rosa_laevigata RLG00000029834 RLG00000036588 RLG00000036591 RLG00000036592 RLG00000036594 RLG00000036595 RLG00000036597 RLG00000036647
rosa_multiflora Rmu_co8127406.1_g000001 Rmu_co8138284.1_g000001 Rmu_sc0002101.1_g000001 Rmu_sc0002101.1_g000006 Rmu_sc0002652.1_g000027 Rmu_sc0002652.1_g000029 Rmu_sc0008562.1_g000002 Rmu_sc0019599.1_g000001 Rmu_sc0019861.1_g000005 Rmu_sc0029317.1_g000001 Rmu_sc0031378.1_g000001 Rmu_ssc0000402.1_g000001
rosa_roxburghii Rroxscaffold_1G00005820 Rroxscaffold_1G00005830 Rroxscaffold_1G00005840 Rroxscaffold_1G00005850 Rroxscaffold_1G00005860 Rroxscaffold_1G00005870 Rroxscaffold_1G00005890 Rroxscaffold_5G00340930 Rroxscaffold_5G00343250 Rroxscaffold_5G00369260
rosa_rugosa Rorug05G0442200 Rorug05G0442300.1 Rorug05G0442400 Rorug05G0442500 Rorug05G0442600 Rorug05G0442700 Rorug05G0442900
rosa_samantha Rh1AG189900 Rh2DG257500 Rh5AG498900 Rh5AG499100 Rh5AG499400 Rh5AG499500 Rh5AG499600 Rh5AG499700 Rh5AG499900 Rh5AG506800 Rh5BG519900 Rh5BG520100 Rh5BG520400 Rh5BG520500 Rh5BG520600 Rh5BG520800 Rh5BG520900 Rh5BG521100 Rh5CG543900 Rh5CG544100 Rh5CG544400 Rh5CG544500 Rh5CG544600 Rh5CG544800 Rh5CG544900 Rh5CG545000 Rh5CG545200 Rh5DG532700 Rh5DG533100 Rh5DG533200 Rh5DG533400 Rh5DG533500 Rh5DG533600 Rh5DG533700
rosa_wichuraiana Rw5G046310 Rw5G046340 Rw5G046350 Rw5G046360 Rw5G046370 Rw5G046380 Rw5G046400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 565
AccB7I CCANNNNNTGG 1 cut(s) 950
AccII CGCG 1 cut(s) 875
AciI CCGC 2 cut(s) 113, 1049
AclI AACGTT 1 cut(s) 669
AcuI CTGAAG 5 cut(s) 362, 410, 674, 704, 995
AdeI CACNNNGTG 1 cut(s) 902
AfaI GTAC 3 cut(s) 3, 111, 639
AfiI CCNNNNNNNGG 3 cut(s) 227, 272, 950
AgsI TTSAA 6 cut(s) 44, 152, 473, 498, 596, 1061
AhlI ACTAGT 1 cut(s) 292
AjnI CCWGG 1 cut(s) 226
Alw21I GWGCWC 2 cut(s) 616, 1168
AlwNI CAGNNNCTG 4 cut(s) 277, 814, 973, 1114
AoxI GGCC 1 cut(s) 1183
ApeKI GCWGC 7 cut(s) 571, 766, 784, 811, 916, 1108, 1111
AspA2I CCTAGG 1 cut(s) 371
AspS9I GGNCC 1 cut(s) 577
AsuC2I CCSGG 1 cut(s) 243
AsuHPI GGTGA 2 cut(s) 845, 1141
AvaII GGWCC 1 cut(s) 577
AvrII CCTAGG 1 cut(s) 371
BanII GRGCYC 1 cut(s) 590
BbsI GAAGAC 2 cut(s) 486, 524
Bbv12I GWGCWC 2 cut(s) 616, 1168
BbvI GCAGC 7 cut(s) 583, 753, 796, 823, 903, 1120, 1123
BccI CCATC 1 cut(s) 1153
BciT130I CCWGG 1 cut(s) 228
BcnI CCSGG 1 cut(s) 243
BcuI ACTAGT 1 cut(s) 292
BfaI CTAG 4 cut(s) 293, 372, 819, 1091
BfmI CTRYAG 4 cut(s) 356, 767, 917, 1034
BfuAI ACCTGC 1 cut(s) 565
BisI GCNGC 8 cut(s) 572, 767, 785, 812, 917, 1049, 1109, 1112
BlnI CCTAGG 1 cut(s) 371
BlpI GCTNAGC 1 cut(s) 504
BlsI GCNGC 8 cut(s) 573, 768, 786, 813, 918, 1050, 1110, 1113
Bme1390I CCNGG 2 cut(s) 228, 243
Bme18I GGWCC 1 cut(s) 577
BmgT120I GGNCC 1 cut(s) 577
BmiI GGNNCC 1 cut(s) 579
BmrFI CCNGG 2 cut(s) 228, 243
BmrI ACTGGG 1 cut(s) 63
BmsI GCATC 7 cut(s) 341, 765, 771, 979, 1015, 1029, 1044
BmuI ACTGGG 1 cut(s) 63
BoxI GACNNNNGTC 1 cut(s) 605
BpiI GAAGAC 2 cut(s) 486, 524
BpmI CTGGAG 3 cut(s) 57, 165, 312
Bpu1102I GCTNAGC 1 cut(s) 504
BpuMI CCSGG 1 cut(s) 243
BsaJI CCNNGG 2 cut(s) 226, 371
BsaWI WCCGGW 2 cut(s) 188, 604
Bsc4I CCNNNNNNNGG 3 cut(s) 227, 272, 950
Bse1I ACTGG 1 cut(s) 58
Bse3DI GCAATG 2 cut(s) 524, 656
BseBI CCWGG 1 cut(s) 228
BseDI CCNNGG 2 cut(s) 226, 371
BseGI GGATG 1 cut(s) 199
BseLI CCNNNNNNNGG 3 cut(s) 227, 272, 950
BseMI GCAATG 2 cut(s) 524, 656
BseMII CTCAG 1 cut(s) 518
BseNI ACTGG 1 cut(s) 58
BseRI GAGGAG 2 cut(s) 255, 927
BseXI GCAGC 7 cut(s) 583, 753, 796, 823, 903, 1120, 1123
BseYI CCCAGC 2 cut(s) 618, 1014
BsgI GTGCAG 2 cut(s) 159, 273
Bsh1236I CGCG 1 cut(s) 875
BshFI GGCC 1 cut(s) 1185
BsiHKAI GWGCWC 2 cut(s) 616, 1168
BsiSI CCGG 3 cut(s) 189, 243, 605
BslFI GGGAC 1 cut(s) 563
BslI CCNNNNNNNGG 3 cut(s) 227, 272, 950
BsmFI GGGAC 1 cut(s) 563
BsmI GAATGC 2 cut(s) 132, 889
BsnI GGCC 1 cut(s) 1185
Bsp1286I GDGCHC 3 cut(s) 590, 616, 1168
Bsp1407I TGTACA 1 cut(s) 637
Bsp1720I GCTNAGC 1 cut(s) 504
BspACI CCGC 2 cut(s) 113, 1049
BspANI GGCC 1 cut(s) 1185
BspCNI CTCAG 1 cut(s) 517
BspFNI CGCG 1 cut(s) 875
BspLI GGNNCC 1 cut(s) 579
BspMAI CTGCAG 3 cut(s) 360, 771, 921
BspMI ACCTGC 1 cut(s) 565
BsrDI GCAATG 2 cut(s) 524, 656
BsrGI TGTACA 1 cut(s) 637
BsrI ACTGG 1 cut(s) 58
BssECI CCNNGG 2 cut(s) 226, 371
BssT1I CCWWGG 1 cut(s) 371
Bst2UI CCWGG 1 cut(s) 228
Bst4CI ACNGT 2 cut(s) 483, 825
Bst6I CTCTTC 1 cut(s) 415
BstAPI GCANNNNNTGC 3 cut(s) 296, 457, 775
BstAUI TGTACA 1 cut(s) 637
BstC8I GCNNGC 4 cut(s) 33, 624, 816, 921
BstDEI CTNAG 1 cut(s) 504
BstF5I GGATG 1 cut(s) 199
BstFNI CGCG 1 cut(s) 875
BstNI CCWGG 1 cut(s) 228
BstPAI GACNNNNGTC 1 cut(s) 605
BstSCI CCNGG 2 cut(s) 226, 241
BstSFI CTRYAG 4 cut(s) 356, 767, 917, 1034
BstUI CGCG 1 cut(s) 875
BstV1I GCAGC 7 cut(s) 583, 753, 796, 823, 903, 1120, 1123
BstV2I GAAGAC 2 cut(s) 486, 524
BstXI CCANNNNNNTGG 1 cut(s) 1159
BsuRI GGCC 1 cut(s) 1185
BtsCI GGATG 1 cut(s) 199
BtsI GCAGTG 3 cut(s) 257, 353, 444
BtsIMutI CAGTG 4 cut(s) 257, 353, 444, 616
BveI ACCTGC 1 cut(s) 565
Cac8I GCNNGC 4 cut(s) 33, 624, 816, 921
CaiI CAGNNNCTG 4 cut(s) 277, 814, 973, 1114
Cfr13I GGNCC 1 cut(s) 577
CseI GACGC 2 cut(s) 746, 881
Csp6I GTAC 3 cut(s) 2, 110, 638
CviAII CATG 3 cut(s) 421, 631, 880
CviQI GTAC 3 cut(s) 2, 110, 638
DdeI CTNAG 1 cut(s) 504
DraIII CACNNNGTG 1 cut(s) 902
Eam1104I CTCTTC 1 cut(s) 415
EarI CTCTTC 1 cut(s) 415
Eco130I CCWWGG 1 cut(s) 371
Eco24I GRGCYC 1 cut(s) 590
Eco47I GGWCC 1 cut(s) 577
Eco57I CTGAAG 5 cut(s) 362, 410, 674, 704, 995
EcoO109I RGGNCCY 1 cut(s) 577
EcoRII CCWGG 1 cut(s) 226
EcoT14I CCWWGG 1 cut(s) 371
EcoT38I GRGCYC 1 cut(s) 590
ErhI CCWWGG 1 cut(s) 371
FaeI CATG 3 cut(s) 424, 634, 883
FaqI GGGAC 1 cut(s) 563
FatI CATG 3 cut(s) 420, 630, 879
FauNDI CATATG 1 cut(s) 253
Fnu4HI GCNGC 8 cut(s) 572, 767, 785, 812, 917, 1049, 1109, 1112
FokI GGATG 1 cut(s) 186
FriOI GRGCYC 1 cut(s) 590
Fsp4HI GCNGC 8 cut(s) 572, 767, 785, 812, 917, 1049, 1109, 1112
FspBI CTAG 4 cut(s) 293, 372, 819, 1091
GluI GCNGC 8 cut(s) 572, 767, 785, 812, 917, 1049, 1109, 1112
GsaI CCCAGC 2 cut(s) 622, 1018
GsuI CTGGAG 3 cut(s) 57, 165, 312
HaeIII GGCC 1 cut(s) 1185
HapII CCGG 3 cut(s) 189, 243, 605
HgaI GACGC 2 cut(s) 746, 881
Hin1II CATG 3 cut(s) 424, 634, 883
HincII GTYRAC 2 cut(s) 761, 871
HindII GTYRAC 2 cut(s) 761, 871
HinfI GANTC 4 cut(s) 385, 520, 601, 712
HpaII CCGG 3 cut(s) 189, 243, 605
HphI GGTGA 2 cut(s) 845, 1141
Hpy166II GTNNAC 2 cut(s) 761, 871
Hpy188I TCNGA 8 cut(s) 126, 138, 279, 693, 711, 863, 975, 1158
Hpy188III TCNNGA 3 cut(s) 66, 1061, 1177
Hpy8I GTNNAC 2 cut(s) 761, 871
HpyAV CCTTC 1 cut(s) 357
HpyCH4III ACNGT 2 cut(s) 483, 825
HpyCH4IV ACGT 1 cut(s) 669
HpyF3I CTNAG 1 cut(s) 504
HpySE526I ACGT 1 cut(s) 669
Hsp92II CATG 3 cut(s) 424, 634, 883
LmnI GCTCC 3 cut(s) 331, 619, 988
Lsp1109I GCAGC 7 cut(s) 583, 753, 796, 823, 903, 1120, 1123
LweI GCATC 7 cut(s) 341, 765, 771, 979, 1015, 1029, 1044
MaeI CTAG 4 cut(s) 293, 372, 819, 1091
MaeII ACGT 1 cut(s) 669
MboII GAAGA 6 cut(s) 312, 402, 486, 529, 680, 1165
MhlI GDGCHC 3 cut(s) 590, 616, 1168
MluCI AATT 1 cut(s) 104
MlyI GAGTC 2 cut(s) 514, 595
MmeI TCCRAC 1 cut(s) 238
MnlI CCTC 6 cut(s) 221, 273, 276, 310, 898, 948
MseI TTAA 2 cut(s) 651, 1002
MslI CAYNNNNRTG 1 cut(s) 1157
MspA1I CMGCKG 3 cut(s) 766, 814, 1114
MspI CCGG 3 cut(s) 189, 243, 605
MspR9I CCNGG 2 cut(s) 228, 243
Mva1269I GAATGC 2 cut(s) 132, 889
MvaI CCWGG 1 cut(s) 228
MvnI CGCG 1 cut(s) 875
NciI CCSGG 1 cut(s) 243
NdeI CATATG 1 cut(s) 253
NlaIII CATG 3 cut(s) 424, 634, 883
NlaIV GGNNCC 1 cut(s) 579
PctI GAATGC 2 cut(s) 132, 889
PfeI GAWTC 2 cut(s) 385, 712
PflMI CCANNNNNTGG 1 cut(s) 950
PkrI GCNGC 8 cut(s) 573, 768, 786, 813, 918, 1050, 1110, 1113
PleI GAGTC 2 cut(s) 514, 595
PpsI GAGTC 2 cut(s) 514, 595
PpuMI RGGWCCY 1 cut(s) 577
PshAI GACNNNNGTC 1 cut(s) 605
Psp1406I AACGTT 1 cut(s) 669
Psp5II RGGWCCY 1 cut(s) 577
Psp6I CCWGG 1 cut(s) 226
PspFI CCCAGC 2 cut(s) 618, 1014
PspGI CCWGG 1 cut(s) 226
PspN4I GGNNCC 1 cut(s) 579
PspPI GGNCC 1 cut(s) 577
PspPPI RGGWCCY 1 cut(s) 577
PsrI GAACNNNNNNTAC 2 cut(s) 93, 125
PstI CTGCAG 3 cut(s) 360, 771, 921
PstNI CAGNNNCTG 4 cut(s) 277, 814, 973, 1114
PvuII CAGCTG 3 cut(s) 766, 814, 1114
RsaI GTAC 3 cut(s) 3, 111, 639
RsaNI GTAC 3 cut(s) 2, 110, 638
RseI CAYNNNNRTG 1 cut(s) 1157
SaqAI TTAA 2 cut(s) 651, 1002
SatI GCNGC 8 cut(s) 572, 767, 785, 812, 917, 1049, 1109, 1112
Sau96I GGNCC 1 cut(s) 577
SchI GAGTC 2 cut(s) 514, 595
ScrFI CCNGG 2 cut(s) 228, 243
SduI GDGCHC 3 cut(s) 590, 616, 1168
SfaNI GCATC 7 cut(s) 341, 765, 771, 979, 1015, 1029, 1044
SfcI CTRYAG 4 cut(s) 356, 767, 917, 1034
SinI GGWCC 1 cut(s) 577
SmiMI CAYNNNNRTG 1 cut(s) 1157
SpeI ACTAGT 1 cut(s) 292
Sse9I AATT 1 cut(s) 104
SsiI CCGC 2 cut(s) 113, 1049
SspI AATATT 2 cut(s) 121, 238
SspMI CTAG 4 cut(s) 293, 372, 819, 1091
StyD4I CCNGG 2 cut(s) 226, 241
StyI CCWWGG 1 cut(s) 371
TaaI ACNGT 2 cut(s) 483, 825
TaiI ACGT 1 cut(s) 672
TaqI TCGA 1 cut(s) 681
TasI AATT 1 cut(s) 104
TatI WGTACW 1 cut(s) 637
TauI GCSGC 1 cut(s) 1051
TfiI GAWTC 2 cut(s) 385, 712
Tru1I TTAA 2 cut(s) 651, 1002
Tru9I TTAA 2 cut(s) 651, 1002
TscAI CASTG 4 cut(s) 264, 360, 444, 616
TseI GCWGC 7 cut(s) 571, 766, 784, 811, 916, 1108, 1111
TspDTI ATGAA 3 cut(s) 647, 896, 1120
TspGWI ACGGA 2 cut(s) 192, 297
TspRI CASTG 4 cut(s) 264, 360, 444, 616
Van91I CCANNNNNTGG 1 cut(s) 950
VpaK11BI GGWCC 1 cut(s) 577
XmaJI CCTAGG 1 cut(s) 371
XspI CTAG 4 cut(s) 293, 372, 819, 1091
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.