Rmu_sc0002772.1_g000022

LRR receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002772.1
OG0000236
Physical Location & Seq
Reverse (-)
97304 .. 97657
354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002772.1_g000022.1.cds

Sequence Viewer

Length: 354 bp
atgcaggcttatcatttacatggaaaaggaaggctgttggacttggttgacagaaacttgtcgggcagttatgacgcaaaagaagccattatcatcttgaacttagcagttaagtgcactggaaaaggaaggctgttggacttggttgacagaaacttgtcgggcagttatgacgcaaaagaagccattatcatcttgaacttagcagttaagtgcaccagtatagctccagccgtgaggcctactatgtctgatgttgttagtgtacttgttggtgacaaaagaatcgatgagagttgcccttctgccccaaatgataatcccattactcaagttgattcctctgctttatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Malectin Pkinase Pkinase_Tyr

Protein Analysis

117

Amino Acids

12.52

Weight (kDa)

6.05

Isoelectric Point (pI)

36.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000236)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g00800 FvH4_3g00800 FvH4_3g00800 FvH4_3g00800 FvH4_3g00800 FvH4_3g00800 FvH4_3g00800 FvH4_3g00800 FvH4_3g00800 FvH4_3g00800 FvH4_3g00800 FvH4_3g00800
malus_domestica MD00G1124000.v1.1 MD10G1333200.v1.1 MD10G1333300.v1.1 MD10G1333800.v1.1 MD10G1333900.v1.1 MD10G1334000.v1.1 MD10G1334300.v1.1 MD10G1334500.v1.1 MD10G1334600.v1.1
prunus_persica Prupe.6G125000_v2.0.a1 Prupe.6G126100_v2.0.a1
pyrus_communis pycom10g28270 pycom10g28410 pycom10g28420 pycom10g28430
rosa_chinensis RchiOBHm_Chr1g0337521 RchiOBHm_Chr1g0337731 RchiOBHm_Chr3g0485891 RchiOBHm_Chr4g0391431 RchiOBHm_Chr4g0391551 RchiOBHm_Chr4g0391571 RchiOBHm_Chr4g0391641 RchiOBHm_Chr4g0391651 RchiOBHm_Chr4g0391661 RchiOBHm_Chr4g0391791 RchiOBHm_Chr4g0409301 RchiOBHm_Chr5g0001061 RchiOBHm_Chr5g0001201 RchiOBHm_Chr5g0001251 RchiOBHm_Chr5g0001261 RchiOBHm_Chr5g0001271 RchiOBHm_Chr5g0040441 RchiOBHm_Chr6g0279971
rosa_laevigata RLG00000009856 RLG00000009862 RLG00000029911 RLG00000030125 RLG00000030918
rosa_multiflora Rmu_co8113804.1_g000001 Rmu_sc0000255.1_g000042 Rmu_sc0001174.1_g000026 Rmu_sc0001706.1_g000014 Rmu_sc0001706.1_g000017 Rmu_sc0001706.1_g000032 Rmu_sc0001706.1_g000039 Rmu_sc0002377.1_g000003 Rmu_sc0002772.1_g000022 Rmu_sc0004189.1_g000005 Rmu_sc0004189.1_g000025 Rmu_sc0004189.1_g000033 Rmu_sc0004862.1_g000015 Rmu_sc0004876.1_g000018 Rmu_sc0014338.1_g000004 Rmu_sc0024491.1_g000002 Rmu_sc0042682.1_g000001
rosa_roxburghii Rroxscaffold_1G00005720 Rroxscaffold_1G00040220 Rroxscaffold_1G00040230 Rroxscaffold_1G00040260 Rroxscaffold_1G00050150 Rroxscaffold_1G00050170 Rroxscaffold_1G00075050 Rroxscaffold_1G00075070 Rroxscaffold_1G00075080 Rroxscaffold_1G00075110 Rroxscaffold_1G00075170 Rroxscaffold_1G00075230 Rroxscaffold_3G00274520 Rroxscaffold_4G00314190 Rroxscaffold_4G00314200 Rroxscaffold_5G00334510 Rroxscaffold_5G00337150 Rroxscaffold_5G00353810 Rroxscaffold_6G00396280 Rroxscaffold_7G00198980
rosa_rugosa Rorug03G0336100 Rorug04G0092200 Rorug04G0389300 Rorug04G0389500 Rorug04G0389500 Rorug05G0185000
rosa_samantha Rh1CG145400 Rh3AG271500 Rh4AG037800 Rh4AG037900 Rh4AG038600 Rh4AG155300 Rh4BG031900 Rh4BG032700 Rh4BG152800 Rh4BG153100 Rh4CG040900 Rh4CG041000 Rh4CG041200 Rh4DG035300 Rh4DG035400 Rh4DG148200 Rh5AG008600 Rh5AG008700 Rh5AG009000 Rh5AG009300 Rh5AG272100 Rh5BG010700 Rh5BG010800 Rh5BG011200 Rh5BG011700 Rh5BG011800 Rh5BG012100 Rh5BG012200 Rh5BG012300 Rh5CG009300 Rh5CG009800 Rh5CG009900 Rh5CG308100 Rh5CG308200 Rh5CG309500 Rh5DG009500 Rh5DG009900 Rh5DG284400 Rh5DG284500
rosa_wichuraiana Rw1G012750 Rw4G002940 Rw4G002980 Rw4G012680 Rw5G000870 Rw5G000940 Rw5G000970 Rw5G025480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 267
AgsI TTSAA 2 cut(s) 100, 199
AluBI AGCT 1 cut(s) 227
AluI AGCT 1 cut(s) 227
Alw21I GWGCWC 2 cut(s) 119, 218
Alw44I GTGCAC 2 cut(s) 115, 214
AoxI GGCC 1 cut(s) 239
ApaLI GTGCAC 2 cut(s) 115, 214
AsuHPI GGTGA 1 cut(s) 287
BaeGI GKGCMC 2 cut(s) 119, 218
Bbv12I GWGCWC 2 cut(s) 119, 218
BceAI ACGGC 1 cut(s) 218
BpmI CTGGAG 1 cut(s) 213
BpuEI CTTGAG 1 cut(s) 315
Bsa29I ATCGAT 1 cut(s) 288
Bse1I ACTGG 2 cut(s) 124, 219
BseCI ATCGAT 1 cut(s) 288
BseNI ACTGG 2 cut(s) 124, 219
BseSI GKGCMC 2 cut(s) 119, 218
BshFI GGCC 1 cut(s) 241
BshVI ATCGAT 1 cut(s) 288
BsiHKAI GWGCWC 2 cut(s) 119, 218
BsnI GGCC 1 cut(s) 241
Bsp1286I GDGCHC 2 cut(s) 119, 218
BspANI GGCC 1 cut(s) 241
BspDI ATCGAT 1 cut(s) 288
BsrI ACTGG 2 cut(s) 124, 219
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 2 cut(s) 103, 202
BstMWI GCNNNNNNNGC 2 cut(s) 83, 182
BstSLI GKGCMC 2 cut(s) 119, 218
Bsu15I ATCGAT 1 cut(s) 288
BsuRI GGCC 1 cut(s) 241
BsuTUI ATCGAT 1 cut(s) 288
BtsIMutI CAGTG 1 cut(s) 117
Cac8I GCNNGC 1 cut(s) 6
ClaI ATCGAT 1 cut(s) 288
CseI GACGC 2 cut(s) 83, 182
Csp6I GTAC 1 cut(s) 266
CviAII CATG 1 cut(s) 20
CviJI RGCY 8 cut(s) 8, 34, 86, 133, 185, 227, 233, 241
CviKI_1 RGCY 8 cut(s) 8, 34, 86, 133, 185, 227, 233, 241
CviQI GTAC 1 cut(s) 266
DdeI CTNAG 2 cut(s) 103, 202
Eco147I AGGCCT 1 cut(s) 241
FaeI CATG 1 cut(s) 23
FaiI YATR 6 cut(s) 21, 72, 171, 224, 248, 352
FatI CATG 1 cut(s) 19
GsuI CTGGAG 1 cut(s) 213
HaeIII GGCC 1 cut(s) 241
HgaI GACGC 2 cut(s) 83, 182
Hin1II CATG 1 cut(s) 23
HincII GTYRAC 2 cut(s) 49, 148
HindII GTYRAC 2 cut(s) 49, 148
HinfI GANTC 2 cut(s) 285, 338
HphI GGTGA 1 cut(s) 287
Hpy166II GTNNAC 5 cut(s) 49, 117, 148, 216, 266
Hpy188I TCNGA 1 cut(s) 253
Hpy188III TCNNGA 2 cut(s) 97, 196
Hpy8I GTNNAC 5 cut(s) 49, 117, 148, 216, 266
HpyAV CCTTC 3 cut(s) 24, 123, 312
HpyCH4V TGCA 3 cut(s) 4, 117, 216
HpyF10VI GCNNNNNNNGC 2 cut(s) 83, 182
HpyF3I CTNAG 2 cut(s) 103, 202
Hsp92II CATG 1 cut(s) 23
LmnI GCTCC 1 cut(s) 232
LpnPI CCDG 3 cut(s) 105, 232, 243
MaeIII GTNAC 1 cut(s) 275
MhlI GDGCHC 2 cut(s) 119, 218
MmeI TCCRAC 2 cut(s) 18, 117
MnlI CCTC 2 cut(s) 231, 352
MseI TTAA 2 cut(s) 111, 210
MslI CAYNNNNRTG 1 cut(s) 18
MwoI GCNNNNNNNGC 2 cut(s) 83, 182
NlaIII CATG 1 cut(s) 23
NmuCI GTSAC 1 cut(s) 275
PceI AGGCCT 1 cut(s) 241
PfeI GAWTC 2 cut(s) 285, 338
RsaI GTAC 1 cut(s) 267
RsaNI GTAC 1 cut(s) 266
RseI CAYNNNNRTG 1 cut(s) 18
SaqAI TTAA 2 cut(s) 111, 210
SduI GDGCHC 2 cut(s) 119, 218
SetI ASST 1 cut(s) 229
SmiMI CAYNNNNRTG 1 cut(s) 18
SmlI CTYRAG 1 cut(s) 330
SmoI CTYRAG 1 cut(s) 330
SseBI AGGCCT 1 cut(s) 241
StuI AGGCCT 1 cut(s) 241
TaqI TCGA 1 cut(s) 288
TatI WGTACW 1 cut(s) 265
TfiI GAWTC 2 cut(s) 285, 338
Tru1I TTAA 2 cut(s) 111, 210
Tru9I TTAA 2 cut(s) 111, 210
TscAI CASTG 1 cut(s) 124
TseFI GTSAC 1 cut(s) 275
Tsp45I GTSAC 1 cut(s) 275
TspRI CASTG 1 cut(s) 124
VneI GTGCAC 2 cut(s) 115, 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.