FvH4_3g18183

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0000206
Physical Location & Seq
Forward (+)
11635261 .. 11639482
4222 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g18183.t1

Sequence Viewer

Length: 657 bp
ATGGGTTCTAGTTGGCTTCCCTCCGAAGAGTTACAATTGTGTGTTTCTTGGGTACGACAATCCACTTGCAACATCACCGGCCGATATCAAAACAAAGACAATTTGTGGAAGAAGATTCATGACGATTACGTCAAAAATTGGTGTGGCGATCCCAAAAATCCTCTAGCCGAGCCTCTTACGAAAATTGCGCTCGAATCACATTTTCCGCGCTTGAAGAAATTGCTCAAGAAGTGGCATACATATCTATACAAATCAAGAAACCGTGCGGCTAGCGGGACGAATTTGGTAGATGAGATTTTCCCAGGCGCCGCCCCTCCATCCTCGTTATCTCTCCATGCGCCACCACTGCACCCTTCTTGGACGGTCGCTGTTGTGAAGGCGACTACTTGGTTGCGCCAATGGCTTAAGTCGCCACTTCCCTGCACATCGTTCTCCAAATCACAACTGCAAGGTGCAAACCAGGTCAGGCTATCTGCCGTAAGGCCACAACCAAACGTTGACTCTCAACTTAATCTTCTTCTTTTAGGCAGCTACCACAATCATCCAAGACTCGCTTGGAGTCAGCAAGGCATGTCCGAAGACAGCTATAAGGCTTGCCGCCGGACAAGGGAGGAACTCATAGTGTTTTCACAGGCGCGTGTAAGCATGTTCTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

219

Amino Acids

24.87

Weight (kDa)

9.76

Isoelectric Point (pI)

54.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 128
AccB1I GGYRCC 1 cut(s) 305
AccII CGCG 2 cut(s) 208, 637
AciI CCGC 5 cut(s) 206, 266, 273, 309, 598
AclI AACGTT 1 cut(s) 495
AclWI GGATC 1 cut(s) 143
AcoI YGGCCR 1 cut(s) 79
AcsI RAATTY 1 cut(s) 280
AcyI GRCGYC 1 cut(s) 306
AfaI GTAC 1 cut(s) 54
AfiI CCNNNNNNNGG 1 cut(s) 607
AflII CTTAAG 1 cut(s) 404
AgsI TTSAA 1 cut(s) 214
AjnI CCWGG 2 cut(s) 301, 459
AluBI AGCT 2 cut(s) 531, 585
AluI AGCT 2 cut(s) 531, 585
AlwI GGATC 1 cut(s) 143
AoxI GGCC 2 cut(s) 79, 482
ApeKI GCWGC 1 cut(s) 528
ApoI RAATTY 1 cut(s) 280
AspLEI GCGC 6 cut(s) 190, 210, 308, 340, 396, 637
AsuHPI GGTGA 1 cut(s) 67
AsuNHI GCTAGC 1 cut(s) 269
BanI GGYRCC 1 cut(s) 305
BbsI GAAGAC 1 cut(s) 585
BbvI GCAGC 1 cut(s) 540
BccI CCATC 1 cut(s) 325
BceAI ACGGC 1 cut(s) 461
BciT130I CCWGG 2 cut(s) 303, 461
BfaI CTAG 3 cut(s) 9, 164, 270
BfoI RGCGCY 1 cut(s) 309
BfrI CTTAAG 1 cut(s) 404
BisI GCNGC 4 cut(s) 267, 309, 529, 598
BlsI GCNGC 4 cut(s) 268, 310, 530, 599
Bme1390I CCNGG 2 cut(s) 303, 461
BmiI GGNNCC 1 cut(s) 307
BmrFI CCNGG 2 cut(s) 303, 461
BmtI GCTAGC 1 cut(s) 273
BpiI GAAGAC 1 cut(s) 585
BpuEI CTTGAG 1 cut(s) 209
BsaHI GRCGYC 1 cut(s) 306
BsaJI CCNNGG 1 cut(s) 301
Bsc4I CCNNNNNNNGG 1 cut(s) 607
Bse118I RCCGGY 1 cut(s) 77
BseBI CCWGG 2 cut(s) 303, 461
BseDI CCNNGG 1 cut(s) 301
BseGI GGATG 2 cut(s) 317, 541
BseLI CCNNNNNNNGG 1 cut(s) 607
BseX3I CGGCCG 1 cut(s) 79
BseXI GCAGC 1 cut(s) 540
BsgI GTGCAG 2 cut(s) 332, 406
Bsh1236I CGCG 2 cut(s) 208, 637
Bsh1285I CGRYCG 2 cut(s) 82, 366
BshFI GGCC 2 cut(s) 81, 484
BshNI GGYRCC 1 cut(s) 305
BsiEI CGRYCG 2 cut(s) 82, 366
BsiSI CCGG 2 cut(s) 78, 601
BslFI GGGAC 1 cut(s) 289
BslI CCNNNNNNNGG 1 cut(s) 607
BsmFI GGGAC 1 cut(s) 289
BsnI GGCC 2 cut(s) 81, 484
Bsp143I GATC 1 cut(s) 148
BspACI CCGC 5 cut(s) 206, 266, 273, 309, 598
BspANI GGCC 2 cut(s) 81, 484
BspFNI CGCG 2 cut(s) 208, 637
BspHI TCATGA 1 cut(s) 118
BspLI GGNNCC 1 cut(s) 307
BspOI GCTAGC 1 cut(s) 273
BspPI GGATC 1 cut(s) 143
BspT107I GGYRCC 1 cut(s) 305
BspTI CTTAAG 1 cut(s) 404
BsrFI RCCGGY 1 cut(s) 77
BssAI RCCGGY 1 cut(s) 77
BssECI CCNNGG 1 cut(s) 301
BssMI GATC 1 cut(s) 148
BssNI GRCGYC 1 cut(s) 306
Bst2UI CCWGG 2 cut(s) 303, 461
Bst4CI ACNGT 2 cut(s) 263, 364
Bst6I CTCTTC 1 cut(s) 21
BstACI GRCGYC 1 cut(s) 306
BstAFI CTTAAG 1 cut(s) 404
BstC8I GCNNGC 2 cut(s) 271, 595
BstDEI CTNAG 1 cut(s) 654
BstF5I GGATG 2 cut(s) 317, 541
BstFNI CGCG 2 cut(s) 208, 637
BstH2I RGCGCY 1 cut(s) 309
BstHHI GCGC 6 cut(s) 190, 210, 308, 340, 396, 637
BstKTI GATC 1 cut(s) 151
BstMBI GATC 1 cut(s) 148
BstMCI CGRYCG 2 cut(s) 82, 366
BstMWI GCNNNNNNNGC 3 cut(s) 346, 400, 409
BstNI CCWGG 2 cut(s) 303, 461
BstNSI RCATGY 2 cut(s) 574, 649
BstSCI CCNGG 2 cut(s) 301, 459
BstUI CGCG 2 cut(s) 208, 637
BstV1I GCAGC 1 cut(s) 540
BstV2I GAAGAC 1 cut(s) 585
BstZI CGGCCG 1 cut(s) 79
BsuRI GGCC 2 cut(s) 81, 484
BtsCI GGATG 2 cut(s) 317, 541
BtsI GCAGTG 1 cut(s) 344
BtsIMutI CAGTG 1 cut(s) 344
Cac8I GCNNGC 2 cut(s) 271, 595
CciI TCATGA 1 cut(s) 118
CfoI GCGC 6 cut(s) 190, 210, 308, 340, 396, 637
Cfr10I RCCGGY 1 cut(s) 77
CsiI ACCWGGT 1 cut(s) 459
Csp6I GTAC 1 cut(s) 53
CviAII CATG 4 cut(s) 119, 335, 571, 646
CviQI GTAC 1 cut(s) 53
DdeI CTNAG 1 cut(s) 654
DinI GGCGCC 1 cut(s) 307
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
DrdI GACNNNNNNGTC 1 cut(s) 128
DseDI GACNNNNNNGTC 1 cut(s) 128
EaeI YGGCCR 1 cut(s) 79
EagI CGGCCG 1 cut(s) 79
Eam1104I CTCTTC 1 cut(s) 21
EarI CTCTTC 1 cut(s) 21
EclXI CGGCCG 1 cut(s) 79
Eco32I GATATC 1 cut(s) 86
Eco52I CGGCCG 1 cut(s) 79
EcoRII CCWGG 2 cut(s) 301, 459
EcoRV GATATC 1 cut(s) 86
EgeI GGCGCC 1 cut(s) 307
EheI GGCGCC 1 cut(s) 307
FaeI CATG 4 cut(s) 122, 338, 574, 649
FaiI YATR 9 cut(s) 120, 237, 241, 247, 336, 572, 588, 620, 647
FalI AAGNNNNNCTT 2 cut(s) 538, 570
FaqI GGGAC 1 cut(s) 289
FatI CATG 4 cut(s) 118, 334, 570, 645
FauI CCCGC 1 cut(s) 266
Fnu4HI GCNGC 4 cut(s) 267, 309, 529, 598
FokI GGATG 2 cut(s) 304, 528
Fsp4HI GCNGC 4 cut(s) 267, 309, 529, 598
FspBI CTAG 3 cut(s) 9, 164, 270
GlaI GCGC 6 cut(s) 189, 209, 307, 339, 395, 636
GluI GCNGC 4 cut(s) 267, 309, 529, 598
HaeII RGCGCY 1 cut(s) 309
HaeIII GGCC 2 cut(s) 81, 484
HapII CCGG 2 cut(s) 78, 601
HhaI GCGC 6 cut(s) 190, 210, 308, 340, 396, 637
Hin1I GRCGYC 1 cut(s) 306
Hin1II CATG 4 cut(s) 122, 338, 574, 649
Hin6I GCGC 6 cut(s) 188, 208, 306, 338, 394, 635
HinP1I GCGC 6 cut(s) 188, 208, 306, 338, 394, 635
HincII GTYRAC 1 cut(s) 499
HindII GTYRAC 1 cut(s) 499
HinfI GANTC 5 cut(s) 115, 194, 500, 549, 559
HpaII CCGG 2 cut(s) 78, 601
HphI GGTGA 1 cut(s) 67
Hpy166II GTNNAC 1 cut(s) 499
Hpy188I TCNGA 2 cut(s) 25, 577
Hpy188III TCNNGA 3 cut(s) 119, 226, 255
Hpy8I GTNNAC 1 cut(s) 499
HpyAV CCTTC 2 cut(s) 363, 370
HpyCH4III ACNGT 2 cut(s) 263, 364
HpyCH4IV ACGT 2 cut(s) 129, 495
HpyCH4V TGCA 5 cut(s) 69, 349, 423, 448, 455
HpyF10VI GCNNNNNNNGC 3 cut(s) 346, 400, 409
HpyF3I CTNAG 1 cut(s) 654
HpySE526I ACGT 2 cut(s) 129, 495
Hsp92I GRCGYC 1 cut(s) 306
Hsp92II CATG 4 cut(s) 122, 338, 574, 649
HspAI GCGC 6 cut(s) 188, 208, 306, 338, 394, 635
KasI GGCGCC 1 cut(s) 305
Kzo9I GATC 1 cut(s) 148
LpnPI CCDG 9 cut(s) 91, 288, 315, 433, 446, 451, 473, 614, 617
Lsp1109I GCAGC 1 cut(s) 540
MabI ACCWGGT 1 cut(s) 459
MaeI CTAG 3 cut(s) 9, 164, 270
MaeII ACGT 2 cut(s) 129, 495
MaeIII GTNAC 1 cut(s) 30
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MboII GAAGA 7 cut(s) 38, 121, 124, 226, 506, 509, 590
MfeI CAATTG 1 cut(s) 35
MluCI AATT 6 cut(s) 35, 100, 136, 183, 218, 280
Mly113I GGCGCC 1 cut(s) 306
MlyI GAGTC 3 cut(s) 494, 543, 568
MnlI CCTC 6 cut(s) 31, 171, 183, 324, 331, 604
MseI TTAA 2 cut(s) 405, 510
MspCI CTTAAG 1 cut(s) 404
MspI CCGG 2 cut(s) 78, 601
MspR9I CCNGG 2 cut(s) 303, 461
MunI CAATTG 1 cut(s) 35
MvaI CCWGG 2 cut(s) 303, 461
MvnI CGCG 2 cut(s) 208, 637
MwoI GCNNNNNNNGC 3 cut(s) 346, 400, 409
NarI GGCGCC 1 cut(s) 306
NdeII GATC 1 cut(s) 148
NheI GCTAGC 1 cut(s) 269
NlaIII CATG 4 cut(s) 122, 338, 574, 649
NlaIV GGNNCC 1 cut(s) 307
NmeAIII GCCGAG 1 cut(s) 193
NspI RCATGY 2 cut(s) 574, 649
PagI TCATGA 1 cut(s) 118
PfeI GAWTC 2 cut(s) 115, 194
PkrI GCNGC 4 cut(s) 268, 310, 530, 599
PleI GAGTC 3 cut(s) 494, 543, 567
PluTI GGCGCC 1 cut(s) 309
PpsI GAGTC 3 cut(s) 494, 543, 567
Psp1406I AACGTT 1 cut(s) 495
Psp6I CCWGG 2 cut(s) 301, 459
PspGI CCWGG 2 cut(s) 301, 459
PspN4I GGNNCC 1 cut(s) 307
RsaI GTAC 1 cut(s) 54
RsaNI GTAC 1 cut(s) 53
SaqAI TTAA 2 cut(s) 405, 510
SatI GCNGC 4 cut(s) 267, 309, 529, 598
Sau3AI GATC 1 cut(s) 148
SchI GAGTC 3 cut(s) 494, 543, 568
ScrFI CCNGG 2 cut(s) 303, 461
SetI ASST 6 cut(s) 132, 454, 465, 498, 533, 587
SexAI ACCWGGT 1 cut(s) 459
SfoI GGCGCC 1 cut(s) 307
SmlI CTYRAG 2 cut(s) 224, 404
SmoI CTYRAG 2 cut(s) 224, 404
Sse9I AATT 6 cut(s) 35, 100, 136, 183, 218, 280
SsiI CCGC 5 cut(s) 206, 266, 273, 309, 598
SspDI GGCGCC 1 cut(s) 305
SspMI CTAG 3 cut(s) 9, 164, 270
StyD4I CCNGG 2 cut(s) 301, 459
TaaI ACNGT 2 cut(s) 263, 364
TaiI ACGT 2 cut(s) 132, 498
TaqI TCGA 1 cut(s) 192
TasI AATT 6 cut(s) 35, 100, 136, 183, 218, 280
TauI GCSGC 3 cut(s) 269, 311, 600
TfiI GAWTC 2 cut(s) 115, 194
Tru1I TTAA 2 cut(s) 405, 510
Tru9I TTAA 2 cut(s) 405, 510
TscAI CASTG 1 cut(s) 351
TseI GCWGC 1 cut(s) 528
TspDTI ATGAA 1 cut(s) 107
TspRI CASTG 1 cut(s) 351
Vha464I CTTAAG 1 cut(s) 404
XapI RAATTY 1 cut(s) 280
XceI RCATGY 2 cut(s) 574, 649
XcmI CCANNNNNNNNNTGG 1 cut(s) 552
XspI CTAG 3 cut(s) 9, 164, 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.