pycom01g07190

ankyrin repeat-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Reverse (-)
7974621 .. 7975181
561 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g07190.1

Sequence Viewer

Length: 561 bp
ATGAACATCACCCCTCTACACTCTACACCCGATCATGTCTCGCATGTTCATGAAGATGATGCAGAAGAAGTGCCCGAAACGCCCCTCCCTGGACAAGCGTCGGGTTCGACCCGTTATCCAATTAGGCCTCAAGGTAAGAAGGCTTCAAAGAGAAAAGGGAGTGCTTCCAAGAATGATTATGCAAAGTTCATGGAAGAACTTACTCGCCAAGGTGAATTGACTTTGGCGAGGGAACTGGTGAAATATGAGGCTAATAAGGCTAAAGAGGACGCAAAAGCTGCAGCTATTGAGAGAGAATTTCAGGCTAATGAGAGAGAAAGAGAGCTACTTAGGCAAGAAAGGGAACATGTTAGAGAAGAAAGACGGGCTCAACGAGATCGTGAGATTATGAACACGCCTTTAGAAGGGAAGTCTCCAAATTCCAAATTTTTTTGGAAGTCAGAGAAAGCGGACGTGGTGCGAAGGAGGCGTGCAAGAGAAGCGATAGCAAGCCAAGGTGGTCCTAGCACCACAAGAGAAGATCATCCTAGCACCACAAATTGGTTAAGTGATGATGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

187

Amino Acids

21.36

Weight (kDa)

7.05

Isoelectric Point (pI)

52.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 540
AciI CCGC 1 cut(s) 449
AcsI RAATTY 3 cut(s) 296, 418, 425
AfiI CCNNNNNNNGG 3 cut(s) 89, 404, 540
AflIII ACRYGT 1 cut(s) 346
AgsI TTSAA 1 cut(s) 147
AjiI CACGTC 1 cut(s) 454
AjnI CCWGG 1 cut(s) 88
AluBI AGCT 3 cut(s) 278, 284, 325
AluI AGCT 3 cut(s) 278, 284, 325
Alw26I GTCTC 2 cut(s) 43, 417
AoxI GGCC 1 cut(s) 125
ApeKI GCWGC 2 cut(s) 278, 281
ApoI RAATTY 3 cut(s) 296, 418, 425
AspS9I GGNCC 1 cut(s) 500
AsuHPI GGTGA 2 cut(s) 224, 250
AvaII GGWCC 1 cut(s) 500
BaeGI GKGCMC 1 cut(s) 75
BanII GRGCYC 1 cut(s) 370
BarI GAAGNNNNNNTAC 2 cut(s) 127, 159
BbvI GCAGC 2 cut(s) 265, 293
BciT130I CCWGG 1 cut(s) 90
BcoDI GTCTC 2 cut(s) 43, 417
BfaI CTAG 2 cut(s) 504, 528
BfmI CTRYAG 1 cut(s) 279
BisI GCNGC 2 cut(s) 279, 282
BlsI GCNGC 2 cut(s) 280, 283
Bme1390I CCNGG 1 cut(s) 90
Bme18I GGWCC 1 cut(s) 500
BmgBI CACGTC 1 cut(s) 454
BmgT120I GGNCC 1 cut(s) 500
BmrFI CCNGG 1 cut(s) 90
BmsI GCATC 1 cut(s) 49
BoxI GACNNNNGTC 1 cut(s) 97
BpuEI CTTGAG 1 cut(s) 114
BsaJI CCNNGG 3 cut(s) 88, 208, 493
Bsc4I CCNNNNNNNGG 3 cut(s) 89, 404, 540
Bse1I ACTGG 1 cut(s) 240
BseBI CCWGG 1 cut(s) 90
BseDI CCNNGG 3 cut(s) 88, 208, 493
BseGI GGATG 1 cut(s) 523
BseLI CCNNNNNNNGG 3 cut(s) 89, 404, 540
BseNI ACTGG 1 cut(s) 240
BseSI GKGCMC 1 cut(s) 75
BseXI GCAGC 2 cut(s) 265, 293
BshFI GGCC 1 cut(s) 127
BslI CCNNNNNNNGG 3 cut(s) 89, 404, 540
BsmAI GTCTC 2 cut(s) 43, 417
BsnI GGCC 1 cut(s) 127
Bsp1286I GDGCHC 2 cut(s) 75, 370
Bsp143I GATC 3 cut(s) 31, 376, 520
BspACI CCGC 1 cut(s) 449
BspANI GGCC 1 cut(s) 127
BspHI TCATGA 1 cut(s) 49
BspMAI CTGCAG 1 cut(s) 283
BsrI ACTGG 1 cut(s) 240
BssECI CCNNGG 3 cut(s) 88, 208, 493
BssMI GATC 3 cut(s) 31, 376, 520
BssT1I CCWWGG 2 cut(s) 208, 493
Bst2UI CCWGG 1 cut(s) 90
BstAPI GCANNNNNTGC 1 cut(s) 278
BstC8I GCNNGC 2 cut(s) 471, 490
BstDEI CTNAG 1 cut(s) 329
BstENI CCTNNNNNAGG 1 cut(s) 402
BstF5I GGATG 1 cut(s) 523
BstKTI GATC 3 cut(s) 34, 379, 523
BstMAI GTCTC 2 cut(s) 43, 417
BstMBI GATC 3 cut(s) 31, 376, 520
BstMWI GCNNNNNNNGC 6 cut(s) 79, 257, 278, 331, 466, 479
BstNI CCWGG 1 cut(s) 90
BstNSI RCATGY 2 cut(s) 47, 350
BstPAI GACNNNNGTC 1 cut(s) 97
BstSCI CCNGG 1 cut(s) 88
BstSFI CTRYAG 1 cut(s) 279
BstSLI GKGCMC 1 cut(s) 75
BstV1I GCAGC 2 cut(s) 265, 293
BsuRI GGCC 1 cut(s) 127
BtrI CACGTC 1 cut(s) 454
BtsCI GGATG 1 cut(s) 523
Cac8I GCNNGC 2 cut(s) 471, 490
CciI TCATGA 1 cut(s) 49
Cfr13I GGNCC 1 cut(s) 500
CseI GACGC 2 cut(s) 87, 278
CviAII CATG 5 cut(s) 35, 44, 50, 190, 347
DdeI CTNAG 1 cut(s) 329
DpnI GATC 3 cut(s) 33, 378, 522
DpnII GATC 3 cut(s) 31, 376, 520
Eco130I CCWWGG 2 cut(s) 208, 493
Eco147I AGGCCT 1 cut(s) 127
Eco24I GRGCYC 1 cut(s) 370
Eco47I GGWCC 1 cut(s) 500
EcoNI CCTNNNNNAGG 1 cut(s) 402
EcoRII CCWGG 1 cut(s) 88
EcoT14I CCWWGG 2 cut(s) 208, 493
EcoT38I GRGCYC 1 cut(s) 370
ErhI CCWWGG 2 cut(s) 208, 493
FaeI CATG 5 cut(s) 38, 47, 53, 193, 350
FaiI YATR 8 cut(s) 36, 45, 51, 180, 191, 246, 348, 389
FatI CATG 5 cut(s) 34, 43, 49, 189, 346
Fnu4HI GCNGC 2 cut(s) 279, 282
FokI GGATG 1 cut(s) 510
FriOI GRGCYC 1 cut(s) 370
Fsp4HI GCNGC 2 cut(s) 279, 282
FspBI CTAG 2 cut(s) 504, 528
GluI GCNGC 2 cut(s) 279, 282
HaeIII GGCC 1 cut(s) 127
HgaI GACGC 2 cut(s) 87, 278
Hin1II CATG 5 cut(s) 38, 47, 53, 193, 350
HphI GGTGA 2 cut(s) 224, 250
Hpy188I TCNGA 1 cut(s) 442
Hpy188III TCNNGA 2 cut(s) 50, 380
Hpy99I CGWCG 1 cut(s) 103
HpyAV CCTTC 3 cut(s) 133, 398, 456
HpyCH4IV ACGT 1 cut(s) 453
HpyCH4V TGCA 4 cut(s) 62, 182, 281, 473
HpyF10VI GCNNNNNNNGC 6 cut(s) 79, 257, 278, 331, 466, 479
HpyF3I CTNAG 1 cut(s) 329
HpySE526I ACGT 1 cut(s) 453
Hsp92II CATG 5 cut(s) 38, 47, 53, 193, 350
Kzo9I GATC 3 cut(s) 31, 376, 520
LpnPI CCDG 4 cut(s) 75, 102, 221, 287
Lsp1109I GCAGC 2 cut(s) 265, 293
LweI GCATC 1 cut(s) 49
MaeI CTAG 2 cut(s) 504, 528
MaeII ACGT 1 cut(s) 453
MalI GATC 3 cut(s) 33, 378, 522
MboI GATC 3 cut(s) 31, 376, 520
MboII GAAGA 5 cut(s) 65, 77, 206, 368, 530
MhlI GDGCHC 2 cut(s) 75, 370
MluCI AATT 6 cut(s) 120, 215, 296, 418, 425, 538
MnlI CCTC 7 cut(s) 24, 95, 138, 222, 241, 259, 459
MseI TTAA 1 cut(s) 545
MslI CAYNNNNRTG 2 cut(s) 48, 54
MspR9I CCNGG 1 cut(s) 90
MvaI CCWGG 1 cut(s) 90
MwoI GCNNNNNNNGC 6 cut(s) 79, 257, 278, 331, 466, 479
NdeII GATC 3 cut(s) 31, 376, 520
NlaIII CATG 5 cut(s) 38, 47, 53, 193, 350
NspI RCATGY 2 cut(s) 47, 350
PagI TCATGA 1 cut(s) 49
PceI AGGCCT 1 cut(s) 127
PciI ACATGT 1 cut(s) 346
PcsI WCGNNNNNNNCGW 1 cut(s) 370
PflMI CCANNNNNTGG 1 cut(s) 540
PkrI GCNGC 2 cut(s) 280, 283
PscI ACATGT 1 cut(s) 346
PshAI GACNNNNGTC 1 cut(s) 97
Psp6I CCWGG 1 cut(s) 88
PspGI CCWGG 1 cut(s) 88
PspPI GGNCC 1 cut(s) 500
PstI CTGCAG 1 cut(s) 283
RseI CAYNNNNRTG 2 cut(s) 48, 54
SaqAI TTAA 1 cut(s) 545
SatI GCNGC 2 cut(s) 279, 282
Sau3AI GATC 3 cut(s) 31, 376, 520
Sau96I GGNCC 1 cut(s) 500
ScrFI CCNGG 1 cut(s) 90
SduI GDGCHC 2 cut(s) 75, 370
SetI ASST 7 cut(s) 136, 214, 280, 286, 327, 456, 499
SfaNI GCATC 1 cut(s) 49
SfcI CTRYAG 1 cut(s) 279
SinI GGWCC 1 cut(s) 500
SmiMI CAYNNNNRTG 2 cut(s) 48, 54
SmlI CTYRAG 1 cut(s) 129
SmoI CTYRAG 1 cut(s) 129
Sse9I AATT 6 cut(s) 120, 215, 296, 418, 425, 538
SseBI AGGCCT 1 cut(s) 127
SsiI CCGC 1 cut(s) 449
SspMI CTAG 2 cut(s) 504, 528
StuI AGGCCT 1 cut(s) 127
StyD4I CCNGG 1 cut(s) 88
StyI CCWWGG 2 cut(s) 208, 493
TaiI ACGT 1 cut(s) 456
TaqI TCGA 1 cut(s) 107
TasI AATT 6 cut(s) 120, 215, 296, 418, 425, 538
Tru1I TTAA 1 cut(s) 545
Tru9I TTAA 1 cut(s) 545
TseI GCWGC 2 cut(s) 278, 281
TspDTI ATGAA 5 cut(s) 17, 38, 66, 178, 404
Van91I CCANNNNNTGG 1 cut(s) 540
VpaK11BI GGWCC 1 cut(s) 500
XagI CCTNNNNNAGG 1 cut(s) 402
XapI RAATTY 3 cut(s) 296, 418, 425
XceI RCATGY 2 cut(s) 47, 350
XspI CTAG 2 cut(s) 504, 528
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.