pycom15g24390

ankyrin repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
OG0000206
Physical Location & Seq
Forward (+)
18583043 .. 18583594
552 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g24390.1

Sequence Viewer

Length: 552 bp
ATGAACAGCACCCCTCTACACTCTACACCCGATCATGTTCATGAAGATGATGCAGAAGAAGTGCTCGAAACGCCCCTCCCTGAACAAGCGTCGGGTTCGACCCGTTTTCCAATTAGGCCTCAAGGTAAGAAGGCTTCAAAGAGAAAAGGGAGTGCTTCCAAGAACGATTATGCAAAGTTCATGGAAGAACTTACTCGCCAAGGTGAATTGACTTTGGCGAGGGACCTGGCGAAAGATGAGGCTGATAAGGCTAGAGAGGCATCAAAACAAGCAGTTGTTGAGAGAGAATTTTATGCTAATGAGAGAGAAAGAGAGCTACTTAGGCAAGAAAGGGAACATGTTAGAGAAGAAAGACGGGCTCAACAAGATCGTGAGATTATGAACATGTCTTTACAAGGGAAGTCTCCAAATTCTAAATTTTTTTGGAAGTCAGAGAAAGCGGACGTTGTGCGAAGGACGTGTGCAAGAGAAGCAATAGCAAGCCAAGGTGGTTCTAGCACCGCAAGAGAAGATCATCCTAGCACCACAAATTGGTTAAGTGATGATGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank Ank_2 Ank_3 Ank_4 Ank_5 PGG

Protein Analysis

184

Amino Acids

20.94

Weight (kDa)

5.85

Isoelectric Point (pI)

50.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 531
AciI CCGC 2 cut(s) 440, 501
AcsI RAATTY 3 cut(s) 287, 409, 416
AfiI CCNNNNNNNGG 1 cut(s) 531
AflIII ACRYGT 3 cut(s) 337, 384, 458
AgsI TTSAA 1 cut(s) 138
AjiI CACGTC 1 cut(s) 459
AjnI CCWGG 1 cut(s) 225
AluBI AGCT 1 cut(s) 316
AluI AGCT 1 cut(s) 316
Alw21I GWGCWC 1 cut(s) 66
Alw26I GTCTC 1 cut(s) 408
AoxI GGCC 1 cut(s) 116
ApoI RAATTY 3 cut(s) 287, 409, 416
AspS9I GGNCC 1 cut(s) 223
AsuHPI GGTGA 1 cut(s) 215
AvaII GGWCC 1 cut(s) 223
BanII GRGCYC 1 cut(s) 361
BarI GAAGNNNNNNTAC 2 cut(s) 118, 150
Bbv12I GWGCWC 1 cut(s) 66
BciT130I CCWGG 1 cut(s) 227
BcoDI GTCTC 1 cut(s) 408
BfaI CTAG 3 cut(s) 252, 495, 519
Bme1390I CCNGG 1 cut(s) 227
Bme18I GGWCC 1 cut(s) 223
BmgBI CACGTC 1 cut(s) 459
BmgT120I GGNCC 1 cut(s) 223
BmiI GGNNCC 1 cut(s) 224
BmrFI CCNGG 1 cut(s) 227
BmsI GCATC 2 cut(s) 40, 269
BpuEI CTTGAG 1 cut(s) 105
BsaJI CCNNGG 2 cut(s) 199, 484
Bsc4I CCNNNNNNNGG 1 cut(s) 531
BseBI CCWGG 1 cut(s) 227
BseDI CCNNGG 2 cut(s) 199, 484
BseGI GGATG 1 cut(s) 514
BseLI CCNNNNNNNGG 1 cut(s) 531
BshFI GGCC 1 cut(s) 118
BsiHKAI GWGCWC 1 cut(s) 66
BslFI GGGAC 1 cut(s) 236
BslI CCNNNNNNNGG 1 cut(s) 531
BsmAI GTCTC 1 cut(s) 408
BsmFI GGGAC 1 cut(s) 236
BsnI GGCC 1 cut(s) 118
Bsp1286I GDGCHC 2 cut(s) 66, 361
Bsp143I GATC 3 cut(s) 31, 367, 511
BspACI CCGC 2 cut(s) 440, 501
BspANI GGCC 1 cut(s) 118
BspHI TCATGA 1 cut(s) 40
BspLI GGNNCC 1 cut(s) 224
BssECI CCNNGG 2 cut(s) 199, 484
BssMI GATC 3 cut(s) 31, 367, 511
BssT1I CCWWGG 2 cut(s) 199, 484
Bst2UI CCWGG 1 cut(s) 227
BstC8I GCNNGC 1 cut(s) 481
BstDEI CTNAG 1 cut(s) 320
BstF5I GGATG 1 cut(s) 514
BstKTI GATC 3 cut(s) 34, 370, 514
BstMAI GTCTC 1 cut(s) 408
BstMBI GATC 3 cut(s) 31, 367, 511
BstMWI GCNNNNNNNGC 5 cut(s) 70, 248, 257, 322, 470
BstNI CCWGG 1 cut(s) 227
BstNSI RCATGY 2 cut(s) 341, 388
BstSCI CCNGG 1 cut(s) 225
BsuRI GGCC 1 cut(s) 118
BtrI CACGTC 1 cut(s) 459
BtsCI GGATG 1 cut(s) 514
Cac8I GCNNGC 1 cut(s) 481
CciI TCATGA 1 cut(s) 40
Cfr13I GGNCC 1 cut(s) 223
CseI GACGC 1 cut(s) 78
CviAII CATG 5 cut(s) 35, 41, 181, 338, 385
CviJI RGCY 7 cut(s) 118, 134, 242, 251, 316, 359, 483
CviKI_1 RGCY 7 cut(s) 118, 134, 242, 251, 316, 359, 483
DdeI CTNAG 1 cut(s) 320
DpnI GATC 3 cut(s) 33, 369, 513
DpnII GATC 3 cut(s) 31, 367, 511
Eco130I CCWWGG 2 cut(s) 199, 484
Eco147I AGGCCT 1 cut(s) 118
Eco24I GRGCYC 1 cut(s) 361
Eco47I GGWCC 1 cut(s) 223
EcoO109I RGGNCCY 1 cut(s) 223
EcoRII CCWGG 1 cut(s) 225
EcoT14I CCWWGG 2 cut(s) 199, 484
EcoT38I GRGCYC 1 cut(s) 361
ErhI CCWWGG 2 cut(s) 199, 484
FaeI CATG 5 cut(s) 38, 44, 184, 341, 388
FaiI YATR 8 cut(s) 36, 42, 171, 182, 294, 339, 380, 386
FaqI GGGAC 1 cut(s) 236
FatI CATG 5 cut(s) 34, 40, 180, 337, 384
FokI GGATG 1 cut(s) 501
FriOI GRGCYC 1 cut(s) 361
FspBI CTAG 3 cut(s) 252, 495, 519
HaeIII GGCC 1 cut(s) 118
HgaI GACGC 1 cut(s) 78
Hin1II CATG 5 cut(s) 38, 44, 184, 341, 388
HphI GGTGA 1 cut(s) 215
Hpy188I TCNGA 1 cut(s) 433
Hpy188III TCNNGA 2 cut(s) 41, 371
Hpy99I CGWCG 1 cut(s) 94
HpyAV CCTTC 2 cut(s) 124, 447
HpyCH4IV ACGT 2 cut(s) 444, 458
HpyCH4V TGCA 3 cut(s) 53, 173, 464
HpyF10VI GCNNNNNNNGC 5 cut(s) 70, 248, 257, 322, 470
HpyF3I CTNAG 1 cut(s) 320
HpySE526I ACGT 2 cut(s) 444, 458
Hsp92II CATG 5 cut(s) 38, 44, 184, 341, 388
Kzo9I GATC 3 cut(s) 31, 367, 511
LpnPI CCDG 3 cut(s) 93, 212, 239
LweI GCATC 2 cut(s) 40, 269
MaeI CTAG 3 cut(s) 252, 495, 519
MaeII ACGT 2 cut(s) 444, 458
MalI GATC 3 cut(s) 33, 369, 513
MboI GATC 3 cut(s) 31, 367, 511
MboII GAAGA 5 cut(s) 56, 68, 197, 359, 521
MhlI GDGCHC 2 cut(s) 66, 361
MluCI AATT 6 cut(s) 111, 206, 287, 409, 416, 529
MnlI CCTC 6 cut(s) 24, 86, 129, 213, 232, 250
MseI TTAA 1 cut(s) 536
MslI CAYNNNNRTG 2 cut(s) 39, 45
MspR9I CCNGG 1 cut(s) 227
MvaI CCWGG 1 cut(s) 227
MwoI GCNNNNNNNGC 5 cut(s) 70, 248, 257, 322, 470
NdeII GATC 3 cut(s) 31, 367, 511
NlaIII CATG 5 cut(s) 38, 44, 184, 341, 388
NlaIV GGNNCC 1 cut(s) 224
NspI RCATGY 2 cut(s) 341, 388
PagI TCATGA 1 cut(s) 40
PceI AGGCCT 1 cut(s) 118
PciI ACATGT 2 cut(s) 337, 384
PflMI CCANNNNNTGG 1 cut(s) 531
PpuMI RGGWCCY 1 cut(s) 223
PscI ACATGT 2 cut(s) 337, 384
Psp5II RGGWCCY 1 cut(s) 223
Psp6I CCWGG 1 cut(s) 225
PspGI CCWGG 1 cut(s) 225
PspN4I GGNNCC 1 cut(s) 224
PspPI GGNCC 1 cut(s) 223
PspPPI RGGWCCY 1 cut(s) 223
RseI CAYNNNNRTG 2 cut(s) 39, 45
SaqAI TTAA 1 cut(s) 536
Sau3AI GATC 3 cut(s) 31, 367, 511
Sau96I GGNCC 1 cut(s) 223
ScrFI CCNGG 1 cut(s) 227
SduI GDGCHC 2 cut(s) 66, 361
SetI ASST 7 cut(s) 127, 205, 228, 318, 447, 461, 490
SfaNI GCATC 2 cut(s) 40, 269
SinI GGWCC 1 cut(s) 223
SmiMI CAYNNNNRTG 2 cut(s) 39, 45
SmlI CTYRAG 1 cut(s) 120
SmoI CTYRAG 1 cut(s) 120
Sse9I AATT 6 cut(s) 111, 206, 287, 409, 416, 529
SseBI AGGCCT 1 cut(s) 118
SsiI CCGC 2 cut(s) 440, 501
SspMI CTAG 3 cut(s) 252, 495, 519
StuI AGGCCT 1 cut(s) 118
StyD4I CCNGG 1 cut(s) 225
StyI CCWWGG 2 cut(s) 199, 484
TaiI ACGT 2 cut(s) 447, 461
TaqI TCGA 2 cut(s) 66, 98
TasI AATT 6 cut(s) 111, 206, 287, 409, 416, 529
Tru1I TTAA 1 cut(s) 536
Tru9I TTAA 1 cut(s) 536
TspDTI ATGAA 5 cut(s) 17, 29, 57, 169, 395
Van91I CCANNNNNTGG 1 cut(s) 531
VpaK11BI GGWCC 1 cut(s) 223
XapI RAATTY 3 cut(s) 287, 409, 416
XceI RCATGY 2 cut(s) 341, 388
XspI CTAG 3 cut(s) 252, 495, 519
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.