FvH4_7g08131

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
OG0000206
Physical Location & Seq
Forward (+)
8117161 .. 8118834
1674 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g08131.t1

Sequence Viewer

Length: 414 bp
ATGGCGTTGCTCTATGCCAGGATGGCCATAGAAGCCTGTAAACCGCCACTGAATGTCATCCGGGCCAATAACATCGACGTTGATAAAGTTGAGCAACACCCGTATTTTGTTGATCCACCAAGCAAAGAAAGAGCACCGAAATCATTTCTGACACATATTGCCTCTGAAAACGAGTCTCCAATGGACTTGGATAATGATGAAGTTATGAAGACACCACCTAGCTCTTTACCGAGACCAATGGGACAAAAGAGAGCCAAAGAAGCAATGAGGAAAGGAAAGAAAGTGCAAGATGTTGCTTCAAGTTTGGCTCTTTCTATTCAATTCATGGTCGAGTCAACACAAGCTTCTGTTGAGCTAGTGAGGCAAAGAAATGAAGAAATTGCCGCTCACTCAAAAGGTTATGGAATTAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

138

Amino Acids

15.32

Weight (kDa)

8.71

Isoelectric Point (pI)

46.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 386
AciI CCGC 2 cut(s) 44, 384
AclWI GGATC 1 cut(s) 107
AcoI YGGCCR 1 cut(s) 24
AgsI TTSAA 2 cut(s) 300, 320
AjnI CCWGG 1 cut(s) 17
AluBI AGCT 3 cut(s) 222, 344, 355
AluI AGCT 3 cut(s) 222, 344, 355
Alw21I GWGCWC 1 cut(s) 136
Alw26I GTCTC 2 cut(s) 180, 226
AlwI GGATC 1 cut(s) 107
AoxI GGCC 2 cut(s) 24, 63
AspS9I GGNCC 1 cut(s) 63
AsuC2I CCSGG 1 cut(s) 62
BalI TGGCCA 1 cut(s) 26
BbsI GAAGAC 1 cut(s) 215
Bbv12I GWGCWC 1 cut(s) 136
BccI CCATC 1 cut(s) 16
BciT130I CCWGG 1 cut(s) 19
BcnI CCSGG 1 cut(s) 62
BcoDI GTCTC 2 cut(s) 180, 226
BfaI CTAG 2 cut(s) 219, 356
BglI GCCNNNNNGGC 1 cut(s) 23
BisI GCNGC 1 cut(s) 384
BlsI GCNGC 1 cut(s) 385
Bme1390I CCNGG 2 cut(s) 19, 62
BmgT120I GGNCC 1 cut(s) 63
BmrFI CCNGG 2 cut(s) 19, 62
BpiI GAAGAC 1 cut(s) 215
BpuMI CCSGG 1 cut(s) 62
BsaI GGTCTC 1 cut(s) 226
Bse3DI GCAATG 1 cut(s) 270
BseBI CCWGG 1 cut(s) 19
BseGI GGATG 2 cut(s) 27, 57
BseMI GCAATG 1 cut(s) 270
BshFI GGCC 2 cut(s) 26, 65
BsiHKAI GWGCWC 1 cut(s) 136
BsiSI CCGG 1 cut(s) 61
BslFI GGGAC 1 cut(s) 255
BsmAI GTCTC 2 cut(s) 180, 226
BsmFI GGGAC 1 cut(s) 255
BsnI GGCC 2 cut(s) 26, 65
Bso31I GGTCTC 1 cut(s) 226
Bsp1286I GDGCHC 1 cut(s) 136
Bsp143I GATC 1 cut(s) 112
BspACI CCGC 2 cut(s) 44, 384
BspANI GGCC 2 cut(s) 26, 65
BspPI GGATC 1 cut(s) 107
BspTNI GGTCTC 1 cut(s) 226
BsrBI CCGCTC 1 cut(s) 386
BsrDI GCAATG 1 cut(s) 270
BssMI GATC 1 cut(s) 112
Bst2UI CCWGG 1 cut(s) 19
BstF5I GGATG 2 cut(s) 27, 57
BstKTI GATC 1 cut(s) 115
BstMAI GTCTC 2 cut(s) 180, 226
BstMBI GATC 1 cut(s) 112
BstMWI GCNNNNNNNGC 4 cut(s) 23, 32, 260, 361
BstNI CCWGG 1 cut(s) 19
BstSCI CCNGG 2 cut(s) 17, 60
BstV2I GAAGAC 1 cut(s) 215
BsuRI GGCC 2 cut(s) 26, 65
BtsCI GGATG 2 cut(s) 27, 57
BtsIMutI CAGTG 1 cut(s) 47
Cfr13I GGNCC 1 cut(s) 63
CviAII CATG 1 cut(s) 325
CviJI RGCY 8 cut(s) 26, 35, 65, 222, 254, 308, 344, 355
CviKI_1 RGCY 8 cut(s) 26, 35, 65, 222, 254, 308, 344, 355
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
EaeI YGGCCR 1 cut(s) 24
Eco31I GGTCTC 1 cut(s) 226
EcoRII CCWGG 1 cut(s) 17
FaeI CATG 1 cut(s) 328
FaiI YATR 6 cut(s) 15, 29, 156, 206, 326, 402
FaqI GGGAC 1 cut(s) 255
FatI CATG 1 cut(s) 324
Fnu4HI GCNGC 1 cut(s) 384
FokI GGATG 2 cut(s) 34, 44
Fsp4HI GCNGC 1 cut(s) 384
FspBI CTAG 2 cut(s) 219, 356
GluI GCNGC 1 cut(s) 384
HaeIII GGCC 2 cut(s) 26, 65
HapII CCGG 1 cut(s) 61
Hin1II CATG 1 cut(s) 328
HincII GTYRAC 1 cut(s) 336
HindII GTYRAC 1 cut(s) 336
HindIII AAGCTT 1 cut(s) 342
HinfI GANTC 2 cut(s) 173, 332
HpaII CCGG 1 cut(s) 61
Hpy166II GTNNAC 2 cut(s) 41, 336
Hpy188I TCNGA 2 cut(s) 150, 166
Hpy8I GTNNAC 2 cut(s) 41, 336
Hpy99I CGWCG 1 cut(s) 80
HpyCH4IV ACGT 1 cut(s) 78
HpyCH4V TGCA 1 cut(s) 286
HpyF10VI GCNNNNNNNGC 4 cut(s) 23, 32, 260, 361
HpySE526I ACGT 1 cut(s) 78
Hsp92II CATG 1 cut(s) 328
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 4 cut(s) 4, 31, 49, 74
MaeI CTAG 2 cut(s) 219, 356
MaeII ACGT 1 cut(s) 78
MalI GATC 1 cut(s) 114
MbiI CCGCTC 1 cut(s) 386
MboI GATC 1 cut(s) 112
MboII GAAGA 2 cut(s) 220, 386
MhlI GDGCHC 1 cut(s) 136
MlsI TGGCCA 1 cut(s) 26
MluCI AATT 3 cut(s) 320, 378, 405
MluNI TGGCCA 1 cut(s) 26
MlyI GAGTC 2 cut(s) 182, 341
MnlI CCTC 3 cut(s) 172, 261, 354
Mox20I TGGCCA 1 cut(s) 26
MscI TGGCCA 1 cut(s) 26
Msp20I TGGCCA 1 cut(s) 26
MspI CCGG 1 cut(s) 61
MspR9I CCNGG 2 cut(s) 19, 62
MvaI CCWGG 1 cut(s) 19
MwoI GCNNNNNNNGC 4 cut(s) 23, 32, 260, 361
NciI CCSGG 1 cut(s) 62
NdeII GATC 1 cut(s) 112
NlaIII CATG 1 cut(s) 328
PkrI GCNGC 1 cut(s) 385
PleI GAGTC 2 cut(s) 181, 340
PpsI GAGTC 2 cut(s) 181, 340
Psp6I CCWGG 1 cut(s) 17
PspGI CCWGG 1 cut(s) 17
PspPI GGNCC 1 cut(s) 63
SatI GCNGC 1 cut(s) 384
Sau3AI GATC 1 cut(s) 112
Sau96I GGNCC 1 cut(s) 63
SchI GAGTC 2 cut(s) 182, 341
ScrFI CCNGG 2 cut(s) 19, 62
SduI GDGCHC 1 cut(s) 136
SetI ASST 6 cut(s) 81, 220, 224, 346, 357, 400
Sse9I AATT 3 cut(s) 320, 378, 405
SsiI CCGC 2 cut(s) 44, 384
SspMI CTAG 2 cut(s) 219, 356
StyD4I CCNGG 2 cut(s) 17, 60
TaiI ACGT 1 cut(s) 81
TaqI TCGA 2 cut(s) 75, 330
TasI AATT 3 cut(s) 320, 378, 405
TauI GCSGC 1 cut(s) 386
TscAI CASTG 1 cut(s) 54
TspDTI ATGAA 4 cut(s) 213, 221, 313, 387
TspRI CASTG 1 cut(s) 54
XspI CTAG 2 cut(s) 219, 356
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.