Rmu_sc0005725.1_g000016

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005725.1
OG0000206
Physical Location & Seq
Reverse (-)
107343 .. 108178
836 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005725.1_g000016.1.cds

Sequence Viewer

Length: 705 bp
atgtgcaaaattggcaaggtccacctacaagctgaactcctcaagctctccaatctcagttttgaacgtttgaaaaaaattctcaaagattggcacaatgcacaaatgacctcctgtaatcgtatagatagcggcaccaataagatggatgagatgaatcaaactcaagggatcttcatgaaaaaatatcccaagaaatttaataaatttgaatgttgggagaaagttaagtaccacccttattttattgatccaccatctaatcctcaaccatcggcatcatattcgacagctactgcctctgaaaatgagtctccaattgagttggatgatgatatcatttcgaagacaccatcaagctccatgccaagaccaatgggacaaaagagagccaaagaagcaaagaagaaaggaaagaaggcgcaagatgcagcagaaagtatgactcttgctattcaagccatggccgaatcaacccaagcttctgttgagctagtgaagaaaagaaacgaagaagtggcctctcacacaaagaaggtatttgaatttgaagaggtgaaagaagatgcaagaattatggccatggatactaattccatgacaccacaatcaaaggcttggtggaaaaagaagaagggtgatattgtagcaaaaacaatgttcgatggtgatagtagcggttgctacatagcccaattcgactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

234

Amino Acids

26.58

Weight (kDa)

9.06

Isoelectric Point (pI)

43.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 134
AciI CCGC 2 cut(s) 132, 678
AclI AACGTT 1 cut(s) 67
AclWI GGATC 2 cut(s) 179, 245
AcoI YGGCCR 2 cut(s) 465, 579
AcsI RAATTY 4 cut(s) 78, 197, 206, 545
AfaI GTAC 1 cut(s) 233
AgsI TTSAA 6 cut(s) 65, 73, 212, 458, 545, 551
AluBI AGCT 6 cut(s) 32, 46, 293, 360, 482, 493
AluI AGCT 6 cut(s) 32, 46, 293, 360, 482, 493
Alw26I GTCTC 1 cut(s) 318
AlwI GGATC 2 cut(s) 179, 245
AlwNI CAGNNNCTG 1 cut(s) 296
AoxI GGCC 3 cut(s) 465, 519, 579
ApeKI GCWGC 1 cut(s) 431
ApoI RAATTY 4 cut(s) 78, 197, 206, 545
AspLEI GCGC 1 cut(s) 424
AspS9I GGNCC 1 cut(s) 19
AsuHPI GGTGA 3 cut(s) 568, 650, 680
AsuII TTCGAA 1 cut(s) 344
AvaII GGWCC 1 cut(s) 19
BalI TGGCCA 1 cut(s) 581
BanI GGYRCC 1 cut(s) 134
BbsI GAAGAC 1 cut(s) 353
BbvI GCAGC 1 cut(s) 443
BccI CCATC 5 cut(s) 139, 265, 280, 361, 659
BcgI CGANNNNNNTGC 2 cut(s) 267, 301
BciVI GTATCC 1 cut(s) 580
BcoDI GTCTC 1 cut(s) 318
BfaI CTAG 1 cut(s) 494
BfuI GTATCC 1 cut(s) 580
BisI GCNGC 2 cut(s) 133, 432
BlsI GCNGC 2 cut(s) 134, 433
Bme18I GGWCC 1 cut(s) 19
BmgT120I GGNCC 1 cut(s) 19
BmiI GGNNCC 1 cut(s) 136
BmsI GCATC 3 cut(s) 287, 418, 556
BpiI GAAGAC 1 cut(s) 353
Bpu14I TTCGAA 1 cut(s) 344
BpuEI CTTGAG 2 cut(s) 26, 150
BsaJI CCNNGG 2 cut(s) 462, 582
BseDI CCNNGG 2 cut(s) 462, 582
BseGI GGATG 2 cut(s) 154, 334
BseMII CTCAG 1 cut(s) 70
BseRI GAGGAG 1 cut(s) 29
BseXI GCAGC 1 cut(s) 443
BshFI GGCC 3 cut(s) 467, 521, 581
BshNI GGYRCC 1 cut(s) 134
BslFI GGGAC 1 cut(s) 393
BsmAI GTCTC 1 cut(s) 318
BsmFI GGGAC 1 cut(s) 393
BsnI GGCC 3 cut(s) 467, 521, 581
Bsp119I TTCGAA 1 cut(s) 344
Bsp143I GATC 2 cut(s) 171, 250
Bsp19I CCATGG 2 cut(s) 462, 582
BspACI CCGC 2 cut(s) 132, 678
BspANI GGCC 3 cut(s) 467, 521, 581
BspCNI CTCAG 1 cut(s) 69
BspHI TCATGA 1 cut(s) 177
BspLI GGNNCC 1 cut(s) 136
BspPI GGATC 2 cut(s) 179, 245
BspT104I TTCGAA 1 cut(s) 344
BspT107I GGYRCC 1 cut(s) 134
BssECI CCNNGG 2 cut(s) 462, 582
BssMI GATC 2 cut(s) 171, 250
BssT1I CCWWGG 2 cut(s) 462, 582
Bst6I CTCTTC 1 cut(s) 546
BstBI TTCGAA 1 cut(s) 344
BstDEI CTNAG 1 cut(s) 56
BstDSI CCRYGG 2 cut(s) 462, 582
BstF5I GGATG 2 cut(s) 154, 334
BstHHI GCGC 1 cut(s) 424
BstKTI GATC 2 cut(s) 174, 253
BstMAI GTCTC 1 cut(s) 318
BstMBI GATC 2 cut(s) 171, 250
BstMWI GCNNNNNNNGC 4 cut(s) 12, 398, 428, 458
BstV1I GCAGC 1 cut(s) 443
BstV2I GAAGAC 1 cut(s) 353
BstX2I RGATCY 1 cut(s) 171
BstXI CCANNNNNNTGG 1 cut(s) 145
BstYI RGATCY 1 cut(s) 171
BsuI GTATCC 1 cut(s) 580
BsuRI GGCC 3 cut(s) 467, 521, 581
BtgI CCRYGG 2 cut(s) 462, 582
BtsCI GGATG 2 cut(s) 154, 334
CaiI CAGNNNCTG 1 cut(s) 296
CciI TCATGA 1 cut(s) 177
CfoI GCGC 1 cut(s) 424
Cfr13I GGNCC 1 cut(s) 19
Csp6I GTAC 1 cut(s) 232
CviAII CATG 5 cut(s) 178, 364, 463, 583, 598
CviQI GTAC 1 cut(s) 232
DdeI CTNAG 1 cut(s) 56
DpnI GATC 2 cut(s) 173, 252
DpnII GATC 2 cut(s) 171, 250
EaeI YGGCCR 2 cut(s) 465, 579
Eam1104I CTCTTC 1 cut(s) 546
EarI CTCTTC 1 cut(s) 546
Eco130I CCWWGG 2 cut(s) 462, 582
Eco32I GATATC 1 cut(s) 337
Eco47I GGWCC 1 cut(s) 19
EcoRV GATATC 1 cut(s) 337
EcoT14I CCWWGG 2 cut(s) 462, 582
ErhI CCWWGG 2 cut(s) 462, 582
FaeI CATG 5 cut(s) 181, 367, 466, 586, 601
FaqI GGGAC 1 cut(s) 393
FatI CATG 5 cut(s) 177, 363, 462, 582, 597
Fnu4HI GCNGC 2 cut(s) 133, 432
FokI GGATG 2 cut(s) 161, 341
Fsp4HI GCNGC 2 cut(s) 133, 432
FspBI CTAG 1 cut(s) 494
GlaI GCGC 1 cut(s) 423
GluI GCNGC 2 cut(s) 133, 432
HaeIII GGCC 3 cut(s) 467, 521, 581
HhaI GCGC 1 cut(s) 424
Hin1II CATG 5 cut(s) 181, 367, 466, 586, 601
Hin6I GCGC 1 cut(s) 422
HinP1I GCGC 1 cut(s) 422
HindIII AAGCTT 1 cut(s) 480
HinfI GANTC 4 cut(s) 157, 311, 445, 470
HphI GGTGA 3 cut(s) 568, 650, 680
Hpy166II GTNNAC 1 cut(s) 22
Hpy188I TCNGA 1 cut(s) 304
Hpy188III TCNNGA 1 cut(s) 178
Hpy8I GTNNAC 1 cut(s) 22
HpyAV CCTTC 3 cut(s) 412, 529, 628
HpyCH4IV ACGT 1 cut(s) 67
HpyCH4V TGCA 4 cut(s) 6, 101, 431, 569
HpyF10VI GCNNNNNNNGC 4 cut(s) 12, 398, 428, 458
HpyF3I CTNAG 1 cut(s) 56
HpySE526I ACGT 1 cut(s) 67
Hsp92II CATG 5 cut(s) 181, 367, 466, 586, 601
HspAI GCGC 1 cut(s) 422
Kzo9I GATC 2 cut(s) 171, 250
LmnI GCTCC 1 cut(s) 365
LpnPI CCDG 1 cut(s) 127
Lsp1109I GCAGC 1 cut(s) 443
LweI GCATC 3 cut(s) 287, 418, 556
MaeI CTAG 1 cut(s) 494
MaeII ACGT 1 cut(s) 67
MalI GATC 2 cut(s) 173, 252
MboI GATC 2 cut(s) 171, 250
MboII GAAGA 8 cut(s) 166, 358, 418, 511, 524, 563, 575, 643
MfeI CAATTG 1 cut(s) 318
MflI RGATCY 1 cut(s) 171
MlsI TGGCCA 1 cut(s) 581
MluCI AATT 9 cut(s) 9, 78, 197, 206, 318, 545, 573, 592, 695
MluNI TGGCCA 1 cut(s) 581
MlyI GAGTC 2 cut(s) 320, 439
MmeI TCCRAC 1 cut(s) 306
MnlI CCTC 6 cut(s) 50, 121, 276, 310, 532, 547
Mox20I TGGCCA 1 cut(s) 581
MscI TGGCCA 1 cut(s) 581
MseI TTAA 2 cut(s) 201, 228
Msp20I TGGCCA 1 cut(s) 581
MunI CAATTG 1 cut(s) 318
MwoI GCNNNNNNNGC 4 cut(s) 12, 398, 428, 458
NcoI CCATGG 2 cut(s) 462, 582
NdeII GATC 2 cut(s) 171, 250
NlaIII CATG 5 cut(s) 181, 367, 466, 586, 601
NlaIV GGNNCC 1 cut(s) 136
NspV TTCGAA 1 cut(s) 344
PagI TCATGA 1 cut(s) 177
PfeI GAWTC 2 cut(s) 157, 470
PkrI GCNGC 2 cut(s) 134, 433
PleI GAGTC 2 cut(s) 319, 439
PpsI GAGTC 2 cut(s) 319, 439
Psp1406I AACGTT 1 cut(s) 67
PspN4I GGNNCC 1 cut(s) 136
PspPI GGNCC 1 cut(s) 19
PstNI CAGNNNCTG 1 cut(s) 296
PsuI RGATCY 1 cut(s) 171
RsaI GTAC 1 cut(s) 233
RsaNI GTAC 1 cut(s) 232
SaqAI TTAA 2 cut(s) 201, 228
SatI GCNGC 2 cut(s) 133, 432
Sau3AI GATC 2 cut(s) 171, 250
Sau96I GGNCC 1 cut(s) 19
SchI GAGTC 2 cut(s) 320, 439
SfaNI GCATC 3 cut(s) 287, 418, 556
SfuI TTCGAA 1 cut(s) 344
SinI GGWCC 1 cut(s) 19
SmlI CTYRAG 2 cut(s) 41, 165
SmoI CTYRAG 2 cut(s) 41, 165
Sse9I AATT 9 cut(s) 9, 78, 197, 206, 318, 545, 573, 592, 695
SsiI CCGC 2 cut(s) 132, 678
SspMI CTAG 1 cut(s) 494
StyI CCWWGG 2 cut(s) 462, 582
TaiI ACGT 1 cut(s) 70
TaqI TCGA 4 cut(s) 287, 344, 663, 699
TasI AATT 9 cut(s) 9, 78, 197, 206, 318, 545, 573, 592, 695
TauI GCSGC 1 cut(s) 135
TfiI GAWTC 2 cut(s) 157, 470
Tru1I TTAA 2 cut(s) 201, 228
Tru9I TTAA 2 cut(s) 201, 228
TseI GCWGC 1 cut(s) 431
TspDTI ATGAA 3 cut(s) 166, 170, 194
VpaK11BI GGWCC 1 cut(s) 19
XapI RAATTY 4 cut(s) 78, 197, 206, 545
XspI CTAG 1 cut(s) 494
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.