pycom15g31880

gpi-anchored protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
30624920 .. 30625415
496 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g31880.1

Sequence Viewer

Length: 456 bp
ATGAAAGGGATGCCTAAAGAAGTTCCAGAGACCCAACCGACTCGTCAATCCCTCAAGCCTCAAGGTAAAAAGACATCAAAGAAAAAAGGTAATTCTCCCAAAAATGACTACACTAAATATATGGAGGAACTTGCTCGCCAAGGTGAACTGAGGATGGCACAGGAAAAGGCAAGAGATGAGGAAAAAGCTGCTGCTATGGCAACAATATTAGCAGCTACTGAGAGACGTGATGCAGCGACTAAGAGACAAAGAGAAAAAGTTAATCGAGAGAACGAAATGATTAGAGAAGCACTTAATCGAGAAAATGAGATGCTTAGAGAAGAAAGGATGACTCAAGCTGATCGTGACACTATGAACAAGCCTCTAGTAGGACTATCTCCAAATTCAAAATATTTTTGGACATCGGAAAAAAAAGAGGTTGTGGTTCTAGCTACACAAATCCTTCCTACAACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

152

Amino Acids

17.44

Weight (kDa)

9.69

Isoelectric Point (pI)

48.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 382
AfiI CCNNNNNNNGG 1 cut(s) 368
AgsI TTSAA 1 cut(s) 387
AjiI CACGTC 1 cut(s) 227
AluBI AGCT 4 cut(s) 188, 215, 338, 431
AluI AGCT 4 cut(s) 188, 215, 338, 431
Alw26I GTCTC 3 cut(s) 23, 217, 238
AlwNI CAGNNNCTG 1 cut(s) 218
ApeKI GCWGC 4 cut(s) 188, 191, 212, 233
ApoI RAATTY 1 cut(s) 382
AsuHPI GGTGA 1 cut(s) 155
BbvI GCAGC 4 cut(s) 175, 178, 224, 245
BccI CCATC 1 cut(s) 148
BcoDI GTCTC 3 cut(s) 23, 217, 238
BfaI CTAG 2 cut(s) 365, 428
BisI GCNGC 4 cut(s) 189, 192, 213, 234
BlsI GCNGC 4 cut(s) 190, 193, 214, 235
BmgBI CACGTC 1 cut(s) 227
BmsI GCATC 2 cut(s) 220, 300
BpuEI CTTGAG 3 cut(s) 38, 45, 318
BsaI GGTCTC 1 cut(s) 23
BsaJI CCNNGG 1 cut(s) 139
Bsc4I CCNNNNNNNGG 1 cut(s) 368
BseDI CCNNGG 1 cut(s) 139
BseGI GGATG 3 cut(s) 15, 159, 333
BseLI CCNNNNNNNGG 1 cut(s) 368
BseMII CTCAG 2 cut(s) 140, 210
BseXI GCAGC 4 cut(s) 175, 178, 224, 245
BslI CCNNNNNNNGG 1 cut(s) 368
BsmAI GTCTC 3 cut(s) 23, 217, 238
BsmBI CGTCTC 1 cut(s) 217
Bso31I GGTCTC 1 cut(s) 23
Bsp143I GATC 1 cut(s) 340
BspCNI CTCAG 2 cut(s) 141, 211
BspTNI GGTCTC 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 139
BssMI GATC 1 cut(s) 340
BssT1I CCWWGG 1 cut(s) 139
BstC8I GCNNGC 1 cut(s) 136
BstDEI CTNAG 4 cut(s) 149, 219, 240, 314
BstENI CCTNNNNNAGG 1 cut(s) 366
BstF5I GGATG 3 cut(s) 15, 159, 333
BstKTI GATC 1 cut(s) 343
BstMAI GTCTC 3 cut(s) 23, 217, 238
BstMBI GATC 1 cut(s) 340
BstMWI GCNNNNNNNGC 1 cut(s) 197
BstV1I GCAGC 4 cut(s) 175, 178, 224, 245
BtrI CACGTC 1 cut(s) 227
BtsCI GGATG 3 cut(s) 15, 159, 333
Cac8I GCNNGC 1 cut(s) 136
CaiI CAGNNNCTG 1 cut(s) 218
CviAII CATG 1 cut(s) 453
CviJI RGCY 6 cut(s) 58, 188, 215, 338, 361, 431
CviKI_1 RGCY 6 cut(s) 58, 188, 215, 338, 361, 431
DdeI CTNAG 4 cut(s) 149, 219, 240, 314
DpnI GATC 1 cut(s) 342
DpnII GATC 1 cut(s) 340
Eco130I CCWWGG 1 cut(s) 139
Eco31I GGTCTC 1 cut(s) 23
EcoNI CCTNNNNNAGG 1 cut(s) 366
EcoT14I CCWWGG 1 cut(s) 139
ErhI CCWWGG 1 cut(s) 139
Esp3I CGTCTC 1 cut(s) 217
FaeI CATG 1 cut(s) 456
FaiI YATR 5 cut(s) 120, 122, 197, 353, 454
FatI CATG 1 cut(s) 452
Fnu4HI GCNGC 4 cut(s) 189, 192, 213, 234
FokI GGATG 3 cut(s) 22, 166, 340
Fsp4HI GCNGC 4 cut(s) 189, 192, 213, 234
FspBI CTAG 2 cut(s) 365, 428
GluI GCNGC 4 cut(s) 189, 192, 213, 234
Hin1II CATG 1 cut(s) 456
HinfI GANTC 2 cut(s) 40, 331
HphI GGTGA 1 cut(s) 155
Hpy166II GTNNAC 1 cut(s) 146
Hpy188I TCNGA 1 cut(s) 406
Hpy188III TCNNGA 4 cut(s) 26, 266, 299, 344
Hpy8I GTNNAC 1 cut(s) 146
HpyAV CCTTC 1 cut(s) 452
HpyCH4IV ACGT 1 cut(s) 226
HpyCH4V TGCA 1 cut(s) 233
HpyF10VI GCNNNNNNNGC 1 cut(s) 197
HpyF3I CTNAG 4 cut(s) 149, 219, 240, 314
HpySE526I ACGT 1 cut(s) 226
Hsp92II CATG 1 cut(s) 456
Kzo9I GATC 1 cut(s) 340
LpnPI CCDG 2 cut(s) 39, 146
Lsp1109I GCAGC 4 cut(s) 175, 178, 224, 245
LweI GCATC 2 cut(s) 220, 300
MaeI CTAG 2 cut(s) 365, 428
MaeII ACGT 1 cut(s) 226
MaeIII GTNAC 1 cut(s) 344
MalI GATC 1 cut(s) 342
MboI GATC 1 cut(s) 340
MboII GAAGA 1 cut(s) 332
MluCI AATT 2 cut(s) 91, 382
MlyI GAGTC 2 cut(s) 34, 325
MnlI CCTC 7 cut(s) 62, 69, 118, 144, 172, 372, 409
MseI TTAA 2 cut(s) 261, 294
MwoI GCNNNNNNNGC 1 cut(s) 197
NdeII GATC 1 cut(s) 340
NlaIII CATG 1 cut(s) 456
NmuCI GTSAC 1 cut(s) 344
PkrI GCNGC 4 cut(s) 190, 193, 214, 235
PleI GAGTC 2 cut(s) 34, 325
PpsI GAGTC 2 cut(s) 34, 325
PstNI CAGNNNCTG 1 cut(s) 218
SaqAI TTAA 2 cut(s) 261, 294
SatI GCNGC 4 cut(s) 189, 192, 213, 234
Sau3AI GATC 1 cut(s) 340
SchI GAGTC 2 cut(s) 34, 325
SetI ASST 9 cut(s) 67, 91, 145, 190, 217, 229, 340, 420, 433
SfaNI GCATC 2 cut(s) 220, 300
SmlI CTYRAG 3 cut(s) 53, 60, 333
SmoI CTYRAG 3 cut(s) 53, 60, 333
Sse9I AATT 2 cut(s) 91, 382
SspI AATATT 2 cut(s) 207, 392
SspMI CTAG 2 cut(s) 365, 428
StyI CCWWGG 1 cut(s) 139
TaiI ACGT 1 cut(s) 229
TaqI TCGA 2 cut(s) 265, 298
TasI AATT 2 cut(s) 91, 382
Tru1I TTAA 2 cut(s) 261, 294
Tru9I TTAA 2 cut(s) 261, 294
TseFI GTSAC 1 cut(s) 344
TseI GCWGC 4 cut(s) 188, 191, 212, 233
Tsp45I GTSAC 1 cut(s) 344
TspDTI ATGAA 2 cut(s) 17, 368
XagI CCTNNNNNAGG 1 cut(s) 366
XapI RAATTY 1 cut(s) 382
XspI CTAG 2 cut(s) 365, 428
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.