Rmu_ssc0000027.1_g000004

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000027.1
OG0000206
Physical Location & Seq
Forward (+)
14777 .. 15744
968 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000027.1_g000004.1.cds

Sequence Viewer

Length: 840 bp
atggaagattcgggtaccaattggtctactgatgagcaaattcaattgtgtgattcatgggcacgtaagtctgtgtgcccgatcatcggaaaacatataacctcctccaagttatgggaaaaggttcatactgattatgtgcaaaattggcaaggtccacctacaagccgaactcctcaagctctccaatctcagtttcgaacgttgaaaaaaattctcaaagattggcacaatgcacaaatgaccttccgtaatcgtatagatagcggcaccaataagatggatgagatgaatcaaactcaagggatcttcatgaaaaaatatcccaagaaatttgataaatttgaatgttgggagaaagttaagtaccacccgtattttgttgatccaccatctaatcctcaaccaccgacatcatattcgacagctactgcctccgaaaatgagtctccaattgagttggatgatgatatcgttttggagacaccatcaagctccatgccaagaccaatgagacaaaagagagccaaagaagcaaagaagaaaggaaagaaggcgcaagatgcagctgaaagtatggctcttgctatacaagccatggccgaatcaacccaagcttctgttgagctagtgaagaaaagaaacgaagtaatggctgctcacacaaagaaggtatttgaatttgaagaggcgaaagaagatgcaagaattatggccatggatactaattcaatgacaccacaatcaaaggcttggtggaaaaagaagaagggtgatatcgtagcaaaaacaatgtccgatggtggtagtaacggttgctacataccccaattcgactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

279

Amino Acids

31.87

Weight (kDa)

8.94

Isoelectric Point (pI)

45.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 14
AccB1I GGYRCC 2 cut(s) 14, 269
AccB7I CCANNNNNTGG 1 cut(s) 114
AccI GTMKAC 1 cut(s) 26
AciI CCGC 1 cut(s) 267
AclI AACGTT 1 cut(s) 203
AclWI GGATC 2 cut(s) 314, 380
AcoI YGGCCR 2 cut(s) 600, 714
AcsI RAATTY 5 cut(s) 39, 213, 332, 341, 680
AfaI GTAC 2 cut(s) 16, 368
AfiI CCNNNNNNNGG 2 cut(s) 86, 114
AgsI TTSAA 6 cut(s) 44, 208, 347, 680, 686, 732
AjuI GAANNNNNNNTTGG 2 cut(s) 180, 212
AluBI AGCT 6 cut(s) 182, 428, 495, 569, 617, 628
AluI AGCT 6 cut(s) 182, 428, 495, 569, 617, 628
Alw26I GTCTC 3 cut(s) 453, 476, 508
AlwI GGATC 2 cut(s) 314, 380
AlwNI CAGNNNCTG 1 cut(s) 431
AoxI GGCC 2 cut(s) 600, 714
ApeKI GCWGC 2 cut(s) 566, 656
ApoI RAATTY 5 cut(s) 39, 213, 332, 341, 680
ArsI GACNNNNNNTTYG 4 cut(s) 403, 435, 779, 811
Asp700I GAANNNNTTC 1 cut(s) 123
Asp718I GGTACC 1 cut(s) 14
AspLEI GCGC 1 cut(s) 559
AspS9I GGNCC 1 cut(s) 155
AsuHPI GGTGA 1 cut(s) 785
AsuII TTCGAA 1 cut(s) 199
AvaII GGWCC 1 cut(s) 155
BaeGI GKGCMC 2 cut(s) 64, 80
BalI TGGCCA 1 cut(s) 716
BanI GGYRCC 2 cut(s) 14, 269
BbvI GCAGC 2 cut(s) 578, 643
BccI CCATC 4 cut(s) 274, 400, 496, 794
BciVI GTATCC 1 cut(s) 715
BcoDI GTCTC 3 cut(s) 453, 476, 508
BfaI CTAG 1 cut(s) 629
BfuI GTATCC 1 cut(s) 715
BisI GCNGC 3 cut(s) 268, 567, 657
BlsI GCNGC 3 cut(s) 269, 568, 658
Bme18I GGWCC 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 155
BmiI GGNNCC 2 cut(s) 16, 271
BmsI GCATC 2 cut(s) 553, 691
Bpu14I TTCGAA 1 cut(s) 199
BpuEI CTTGAG 2 cut(s) 162, 285
BsaAI YACGTR 1 cut(s) 65
BsaJI CCNNGG 2 cut(s) 597, 717
Bsc4I CCNNNNNNNGG 2 cut(s) 86, 114
BseDI CCNNGG 2 cut(s) 597, 717
BseGI GGATG 2 cut(s) 289, 469
BseLI CCNNNNNNNGG 2 cut(s) 86, 114
BseMII CTCAG 1 cut(s) 206
BseRI GAGGAG 2 cut(s) 94, 165
BseSI GKGCMC 2 cut(s) 64, 80
BseXI GCAGC 2 cut(s) 578, 643
BshFI GGCC 2 cut(s) 602, 716
BshNI GGYRCC 2 cut(s) 14, 269
BslI CCNNNNNNNGG 2 cut(s) 86, 114
BsmAI GTCTC 3 cut(s) 453, 476, 508
BsnI GGCC 2 cut(s) 602, 716
Bsp119I TTCGAA 1 cut(s) 199
Bsp1286I GDGCHC 2 cut(s) 64, 80
Bsp143I GATC 3 cut(s) 81, 306, 385
Bsp19I CCATGG 2 cut(s) 597, 717
BspACI CCGC 1 cut(s) 267
BspANI GGCC 2 cut(s) 602, 716
BspCNI CTCAG 1 cut(s) 205
BspHI TCATGA 1 cut(s) 312
BspLI GGNNCC 2 cut(s) 16, 271
BspPI GGATC 2 cut(s) 314, 380
BspT104I TTCGAA 1 cut(s) 199
BspT107I GGYRCC 2 cut(s) 14, 269
BssECI CCNNGG 2 cut(s) 597, 717
BssMI GATC 3 cut(s) 81, 306, 385
BssT1I CCWWGG 2 cut(s) 597, 717
Bst4CI ACNGT 1 cut(s) 815
Bst6I CTCTTC 1 cut(s) 681
BstBAI YACGTR 1 cut(s) 65
BstBI TTCGAA 1 cut(s) 199
BstDEI CTNAG 1 cut(s) 192
BstDSI CCRYGG 2 cut(s) 597, 717
BstF5I GGATG 2 cut(s) 289, 469
BstHHI GCGC 1 cut(s) 559
BstKTI GATC 3 cut(s) 84, 309, 388
BstMAI GTCTC 3 cut(s) 453, 476, 508
BstMBI GATC 3 cut(s) 81, 306, 385
BstMWI GCNNNNNNNGC 4 cut(s) 148, 533, 563, 593
BstSLI GKGCMC 2 cut(s) 64, 80
BstV1I GCAGC 2 cut(s) 578, 643
BstX2I RGATCY 1 cut(s) 306
BstXI CCANNNNNNTGG 1 cut(s) 280
BstYI RGATCY 1 cut(s) 306
BsuI GTATCC 1 cut(s) 715
BsuRI GGCC 2 cut(s) 602, 716
BtgI CCRYGG 2 cut(s) 597, 717
BtsCI GGATG 2 cut(s) 289, 469
CaiI CAGNNNCTG 1 cut(s) 431
CciI TCATGA 1 cut(s) 312
CfoI GCGC 1 cut(s) 559
Cfr13I GGNCC 1 cut(s) 155
Csp6I GTAC 2 cut(s) 15, 367
CviAII CATG 5 cut(s) 57, 313, 499, 598, 718
CviQI GTAC 2 cut(s) 15, 367
DdeI CTNAG 1 cut(s) 192
DpnI GATC 3 cut(s) 83, 308, 387
DpnII GATC 3 cut(s) 81, 306, 385
EaeI YGGCCR 2 cut(s) 600, 714
Eam1104I CTCTTC 1 cut(s) 681
EarI CTCTTC 1 cut(s) 681
Eco130I CCWWGG 2 cut(s) 597, 717
Eco32I GATATC 2 cut(s) 472, 778
Eco47I GGWCC 1 cut(s) 155
EcoRV GATATC 2 cut(s) 472, 778
EcoT14I CCWWGG 2 cut(s) 597, 717
ErhI CCWWGG 2 cut(s) 597, 717
FaeI CATG 5 cut(s) 60, 316, 502, 601, 721
FatI CATG 5 cut(s) 56, 312, 498, 597, 717
FblI GTMKAC 1 cut(s) 26
Fnu4HI GCNGC 3 cut(s) 268, 567, 657
FokI GGATG 2 cut(s) 296, 476
Fsp4HI GCNGC 3 cut(s) 268, 567, 657
FspBI CTAG 1 cut(s) 629
GlaI GCGC 1 cut(s) 558
GluI GCNGC 3 cut(s) 268, 567, 657
HaeIII GGCC 2 cut(s) 602, 716
HhaI GCGC 1 cut(s) 559
Hin1II CATG 5 cut(s) 60, 316, 502, 601, 721
Hin6I GCGC 1 cut(s) 557
HinP1I GCGC 1 cut(s) 557
HindIII AAGCTT 1 cut(s) 615
HinfI GANTC 5 cut(s) 8, 53, 292, 446, 605
HphI GGTGA 1 cut(s) 785
Hpy166II GTNNAC 2 cut(s) 27, 158
Hpy188I TCNGA 3 cut(s) 89, 439, 799
Hpy188III TCNNGA 1 cut(s) 313
Hpy8I GTNNAC 2 cut(s) 27, 158
HpyAV CCTTC 4 cut(s) 256, 547, 664, 763
HpyCH4III ACNGT 1 cut(s) 815
HpyCH4IV ACGT 2 cut(s) 64, 203
HpyCH4V TGCA 4 cut(s) 142, 236, 566, 704
HpyF10VI GCNNNNNNNGC 4 cut(s) 148, 533, 563, 593
HpyF3I CTNAG 1 cut(s) 192
HpySE526I ACGT 2 cut(s) 64, 203
Hsp92II CATG 5 cut(s) 60, 316, 502, 601, 721
HspAI GCGC 1 cut(s) 557
KpnI GGTACC 1 cut(s) 18
Kzo9I GATC 3 cut(s) 81, 306, 385
LmnI GCTCC 1 cut(s) 500
Lsp1109I GCAGC 2 cut(s) 578, 643
LweI GCATC 2 cut(s) 553, 691
MaeI CTAG 1 cut(s) 629
MaeII ACGT 2 cut(s) 64, 203
MaeIII GTNAC 1 cut(s) 809
MalI GATC 3 cut(s) 83, 308, 387
MboI GATC 3 cut(s) 81, 306, 385
MboII GAAGA 7 cut(s) 17, 301, 553, 646, 698, 710, 778
MfeI CAATTG 3 cut(s) 19, 44, 453
MflI RGATCY 1 cut(s) 306
MhlI GDGCHC 2 cut(s) 64, 80
MlsI TGGCCA 1 cut(s) 716
MluNI TGGCCA 1 cut(s) 716
MlyI GAGTC 1 cut(s) 455
MmeI TCCRAC 1 cut(s) 441
MnlI CCTC 6 cut(s) 112, 115, 186, 411, 445, 682
Mox20I TGGCCA 1 cut(s) 716
MroXI GAANNNNTTC 1 cut(s) 123
MscI TGGCCA 1 cut(s) 716
MseI TTAA 1 cut(s) 363
Msp20I TGGCCA 1 cut(s) 716
MspA1I CMGCKG 1 cut(s) 569
MunI CAATTG 3 cut(s) 19, 44, 453
MwoI GCNNNNNNNGC 4 cut(s) 148, 533, 563, 593
NcoI CCATGG 2 cut(s) 597, 717
NdeII GATC 3 cut(s) 81, 306, 385
NlaIII CATG 5 cut(s) 60, 316, 502, 601, 721
NlaIV GGNNCC 2 cut(s) 16, 271
NspV TTCGAA 1 cut(s) 199
PagI TCATGA 1 cut(s) 312
PdmI GAANNNNTTC 1 cut(s) 123
PfeI GAWTC 4 cut(s) 8, 53, 292, 605
PflMI CCANNNNNTGG 1 cut(s) 114
PkrI GCNGC 3 cut(s) 269, 568, 658
PleI GAGTC 1 cut(s) 454
PpsI GAGTC 1 cut(s) 454
Ppu21I YACGTR 1 cut(s) 65
Psp1406I AACGTT 1 cut(s) 203
PspN4I GGNNCC 2 cut(s) 16, 271
PspPI GGNCC 1 cut(s) 155
PstNI CAGNNNCTG 1 cut(s) 431
PsuI RGATCY 1 cut(s) 306
PvuII CAGCTG 1 cut(s) 569
RsaI GTAC 2 cut(s) 16, 368
RsaNI GTAC 2 cut(s) 15, 367
SaqAI TTAA 1 cut(s) 363
SatI GCNGC 3 cut(s) 268, 567, 657
Sau3AI GATC 3 cut(s) 81, 306, 385
Sau96I GGNCC 1 cut(s) 155
SchI GAGTC 1 cut(s) 455
SduI GDGCHC 2 cut(s) 64, 80
SfaNI GCATC 2 cut(s) 553, 691
SfuI TTCGAA 1 cut(s) 199
SinI GGWCC 1 cut(s) 155
SmlI CTYRAG 2 cut(s) 177, 300
SmoI CTYRAG 2 cut(s) 177, 300
SsiI CCGC 1 cut(s) 267
SspMI CTAG 1 cut(s) 629
StyI CCWWGG 2 cut(s) 597, 717
TaaI ACNGT 1 cut(s) 815
TaiI ACGT 2 cut(s) 67, 206
TaqI TCGA 3 cut(s) 199, 422, 834
TauI GCSGC 1 cut(s) 270
TfiI GAWTC 4 cut(s) 8, 53, 292, 605
Tru1I TTAA 1 cut(s) 363
Tru9I TTAA 1 cut(s) 363
TseI GCWGC 2 cut(s) 566, 656
TspDTI ATGAA 5 cut(s) 45, 116, 301, 305, 329
TspGWI ACGGA 1 cut(s) 239
Van91I CCANNNNNTGG 1 cut(s) 114
VpaK11BI GGWCC 1 cut(s) 155
XapI RAATTY 5 cut(s) 39, 213, 332, 341, 680
XmiI GTMKAC 1 cut(s) 26
XmnI GAANNNNTTC 1 cut(s) 123
XspI CTAG 1 cut(s) 629
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.