FvH4_4g11860

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0000206
Physical Location & Seq
Reverse (-)
15582517 .. 15583388
872 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g11860.t1

Sequence Viewer

Length: 627 bp
ATGCTCAAAGATTGGCACAATGCACAACTTCAATCCCGCAATAATATAGCGAGCGGCCATAACATGATGGACCAGATGAATCAAGCACAATCTATCTACATGAAACATCATCCCAAGGAATTTGATAAGTGGGCTTGTTGGGAGAAAGTAAAGCACCACCCTTATTTTGTTGATCCACCAAGCAAAGAAAGAGCACCGGAATCATTTCCGACACATATTGCCTCCGAAAACGAGTCTCCAATTGACTTGGATGATGATGAAGTTATGGAGACACCACCTAGCTCTTTGCCGAGACCAATGGGACAAAAGAGAGCTAAAGAAGCAATGAGGAAAGGAAAGAAAGTGCAAGATGTTGCTTCAAGTTTGGCTCTTTCTATTCAATCCATGGCCGAGTCAACGCAAGCTTCTGTTGAGCTAGTGAGGCAAAGAAATGAAGAAATTGCCGCTCACTCAAAGAGGGTTATGGAATTAGAAGAGGCGAAAGAGGATGCAAGAATTATGGGCAAGGATACTAGTAATATGTCTCCAGATGAAAAGCGTTGGTGGAAACAAAGGAAGAGAAGTGTTATGGCAAAAACTTTGTTTGATGATGGTAGCAGTGATTGCTACACACCTGGGTTTGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

209

Amino Acids

23.93

Weight (kDa)

6.26

Isoelectric Point (pI)

67.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 39 - 188 1.5e-12 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 2 cut(s) 54, 446
AciI CCGC 3 cut(s) 37, 54, 444
AclWI GGATC 1 cut(s) 167
AcoI YGGCCR 2 cut(s) 55, 387
AcsI RAATTY 1 cut(s) 119
AgsI TTSAA 3 cut(s) 32, 360, 380
AhlI ACTAGT 1 cut(s) 512
AjnI CCWGG 1 cut(s) 613
AluBI AGCT 4 cut(s) 282, 314, 404, 415
AluI AGCT 4 cut(s) 282, 314, 404, 415
Alw21I GWGCWC 1 cut(s) 196
Alw26I GTCTC 4 cut(s) 240, 263, 286, 528
AlwI GGATC 1 cut(s) 167
AoxI GGCC 2 cut(s) 55, 387
ApoI RAATTY 1 cut(s) 119
Asp700I GAANNNNTTC 1 cut(s) 204
AspS9I GGNCC 1 cut(s) 70
AvaII GGWCC 1 cut(s) 70
Bbv12I GWGCWC 1 cut(s) 196
BccI CCATC 2 cut(s) 61, 584
BciT130I CCWGG 1 cut(s) 615
BciVI GTATCC 1 cut(s) 502
BcoDI GTCTC 4 cut(s) 240, 263, 286, 528
BcuI ACTAGT 1 cut(s) 512
BfaI CTAG 3 cut(s) 279, 416, 513
BfuI GTATCC 1 cut(s) 502
BisI GCNGC 2 cut(s) 55, 444
BlsI GCNGC 2 cut(s) 56, 445
Bme1390I CCNGG 1 cut(s) 615
Bme18I GGWCC 1 cut(s) 70
BmgT120I GGNCC 1 cut(s) 70
BmrFI CCNGG 1 cut(s) 615
BmsI GCATC 1 cut(s) 478
BpmI CTGGAG 1 cut(s) 510
BsaI GGTCTC 1 cut(s) 286
BsaJI CCNNGG 3 cut(s) 114, 384, 614
BsaWI WCCGGW 1 cut(s) 196
Bse3DI GCAATG 1 cut(s) 330
BseBI CCWGG 1 cut(s) 615
BseDI CCNNGG 3 cut(s) 114, 384, 614
BseGI GGATG 3 cut(s) 109, 256, 493
BseMI GCAATG 1 cut(s) 330
BshFI GGCC 2 cut(s) 57, 389
BsiHKAI GWGCWC 1 cut(s) 196
BsiSI CCGG 1 cut(s) 197
BslFI GGGAC 1 cut(s) 315
BsmAI GTCTC 4 cut(s) 240, 263, 286, 528
BsmFI GGGAC 1 cut(s) 315
BsnI GGCC 2 cut(s) 57, 389
Bso31I GGTCTC 1 cut(s) 286
Bsp1286I GDGCHC 1 cut(s) 196
Bsp143I GATC 1 cut(s) 172
Bsp19I CCATGG 1 cut(s) 384
BspACI CCGC 3 cut(s) 37, 54, 444
BspANI GGCC 2 cut(s) 57, 389
BspPI GGATC 1 cut(s) 167
BspTNI GGTCTC 1 cut(s) 286
BsrBI CCGCTC 2 cut(s) 54, 446
BsrDI GCAATG 1 cut(s) 330
BssECI CCNNGG 3 cut(s) 114, 384, 614
BssMI GATC 1 cut(s) 172
BssT1I CCWWGG 2 cut(s) 114, 384
Bst2UI CCWGG 1 cut(s) 615
Bst6I CTCTTC 2 cut(s) 468, 551
BstAPI GCANNNNNTGC 1 cut(s) 603
BstC8I GCNNGC 2 cut(s) 52, 402
BstDSI CCRYGG 1 cut(s) 384
BstF5I GGATG 3 cut(s) 109, 256, 493
BstKTI GATC 1 cut(s) 175
BstMAI GTCTC 4 cut(s) 240, 263, 286, 528
BstMBI GATC 1 cut(s) 172
BstMWI GCNNNNNNNGC 3 cut(s) 320, 421, 603
BstNI CCWGG 1 cut(s) 615
BstSCI CCNGG 1 cut(s) 613
BsuI GTATCC 1 cut(s) 502
BsuRI GGCC 2 cut(s) 57, 389
BtgI CCRYGG 1 cut(s) 384
BtsCI GGATG 3 cut(s) 109, 256, 493
BtsI GCAGTG 1 cut(s) 604
BtsIMutI CAGTG 1 cut(s) 604
Cac8I GCNNGC 2 cut(s) 52, 402
Cfr13I GGNCC 1 cut(s) 70
CviAII CATG 3 cut(s) 64, 100, 385
CviJI RGCY 8 cut(s) 57, 134, 282, 314, 368, 389, 404, 415
CviKI_1 RGCY 8 cut(s) 57, 134, 282, 314, 368, 389, 404, 415
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
EaeI YGGCCR 2 cut(s) 55, 387
Eam1104I CTCTTC 2 cut(s) 468, 551
EarI CTCTTC 2 cut(s) 468, 551
Eco130I CCWWGG 2 cut(s) 114, 384
Eco31I GGTCTC 1 cut(s) 286
Eco47I GGWCC 1 cut(s) 70
EcoRII CCWGG 1 cut(s) 613
EcoT14I CCWWGG 2 cut(s) 114, 384
ErhI CCWWGG 2 cut(s) 114, 384
FaeI CATG 3 cut(s) 67, 103, 388
FaqI GGGAC 1 cut(s) 315
FatI CATG 3 cut(s) 63, 99, 384
FauI CCCGC 1 cut(s) 44
Fnu4HI GCNGC 2 cut(s) 55, 444
FokI GGATG 3 cut(s) 96, 263, 500
Fsp4HI GCNGC 2 cut(s) 55, 444
FspBI CTAG 3 cut(s) 279, 416, 513
GluI GCNGC 2 cut(s) 55, 444
GsuI CTGGAG 1 cut(s) 510
HaeIII GGCC 2 cut(s) 57, 389
HapII CCGG 1 cut(s) 197
Hin1II CATG 3 cut(s) 67, 103, 388
HincII GTYRAC 1 cut(s) 396
HindII GTYRAC 1 cut(s) 396
HindIII AAGCTT 1 cut(s) 402
HinfI GANTC 4 cut(s) 79, 200, 233, 392
HpaII CCGG 1 cut(s) 197
Hpy166II GTNNAC 1 cut(s) 396
Hpy188I TCNGA 2 cut(s) 210, 226
Hpy188III TCNNGA 1 cut(s) 527
Hpy8I GTNNAC 1 cut(s) 396
HpyCH4V TGCA 3 cut(s) 23, 346, 491
HpyF10VI GCNNNNNNNGC 3 cut(s) 320, 421, 603
Hsp92II CATG 3 cut(s) 67, 103, 388
Kzo9I GATC 1 cut(s) 172
LpnPI CCDG 4 cut(s) 86, 210, 540, 600
LweI GCATC 1 cut(s) 478
MaeI CTAG 3 cut(s) 279, 416, 513
MalI GATC 1 cut(s) 174
MbiI CCGCTC 2 cut(s) 54, 446
MboI GATC 1 cut(s) 172
MboII GAAGA 3 cut(s) 446, 485, 568
MfeI CAATTG 1 cut(s) 240
MhlI GDGCHC 1 cut(s) 196
MluCI AATT 5 cut(s) 119, 240, 438, 467, 495
MlyI GAGTC 2 cut(s) 242, 401
MmeI TCCRAC 1 cut(s) 233
MnlI CCTC 6 cut(s) 232, 321, 414, 450, 469, 478
MroXI GAANNNNTTC 1 cut(s) 204
MspI CCGG 1 cut(s) 197
MspR9I CCNGG 1 cut(s) 615
MunI CAATTG 1 cut(s) 240
MvaI CCWGG 1 cut(s) 615
MwoI GCNNNNNNNGC 3 cut(s) 320, 421, 603
NcoI CCATGG 1 cut(s) 384
NdeII GATC 1 cut(s) 172
NlaIII CATG 3 cut(s) 67, 103, 388
NmeAIII GCCGAG 2 cut(s) 315, 415
PdmI GAANNNNTTC 1 cut(s) 204
PfeI GAWTC 2 cut(s) 79, 200
PkrI GCNGC 2 cut(s) 56, 445
PleI GAGTC 2 cut(s) 241, 400
PpsI GAGTC 2 cut(s) 241, 400
Psp6I CCWGG 1 cut(s) 613
PspGI CCWGG 1 cut(s) 613
PspPI GGNCC 1 cut(s) 70
SatI GCNGC 2 cut(s) 55, 444
Sau3AI GATC 1 cut(s) 172
Sau96I GGNCC 1 cut(s) 70
SchI GAGTC 2 cut(s) 242, 401
ScrFI CCNGG 1 cut(s) 615
SduI GDGCHC 1 cut(s) 196
SetI ASST 6 cut(s) 280, 284, 316, 406, 417, 616
SfaNI GCATC 1 cut(s) 478
SinI GGWCC 1 cut(s) 70
SpeI ACTAGT 1 cut(s) 512
Sse9I AATT 5 cut(s) 119, 240, 438, 467, 495
SsiI CCGC 3 cut(s) 37, 54, 444
SspMI CTAG 3 cut(s) 279, 416, 513
StyD4I CCNGG 1 cut(s) 613
StyI CCWWGG 2 cut(s) 114, 384
TasI AATT 5 cut(s) 119, 240, 438, 467, 495
TauI GCSGC 2 cut(s) 57, 446
TfiI GAWTC 2 cut(s) 79, 200
TscAI CASTG 1 cut(s) 604
TspDTI ATGAA 5 cut(s) 92, 116, 273, 447, 546
TspRI CASTG 1 cut(s) 604
VpaK11BI GGWCC 1 cut(s) 70
XapI RAATTY 1 cut(s) 119
XmnI GAANNNNTTC 1 cut(s) 204
XspI CTAG 3 cut(s) 279, 416, 513
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.