Rmu_sc0000758.1_g000016

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000758.1
Physical Location & Seq
Forward (+)
67690 .. 68217
528 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000758.1_g000016.1.cds

Sequence Viewer

Length: 528 bp
atgaaaaaacatcccaagaagtttgataaatttgaatgttgggagaaagttaagtatcacccttattttgtggatccaccatctaattctcaaccaccggcatcatattcgacagctagtgtctccgaaaacgagtctccaattgacttggatgatgaaatagttttggagacaccatcaagctccaggccgagaccaatgggacaaaagagagccaaggaagcaaagaaaaaaggaaagaaggcgcaagatgcagcagaaagtatggctcttgctatacaagccatggcagaatcaactcaagcttctgttgagctagtgaagaaaagaaacgaagaaatggctgctcacacaaagaaggtatttgaatttgaagaggcgaaagaagatgcaagaattatggccatggatactaattccatgacaccacaatcaaaggcttggtggaaaaagaaaaagggtgatatcgtagcaaaaacaatgtccgatggtggtagcagcggttactacatacctcaattcgattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

175

Amino Acids

19.7

Weight (kDa)

8.77

Isoelectric Point (pI)

49.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 501
AclWI GGATC 2 cut(s) 68, 81
AcoI YGGCCR 1 cut(s) 402
AcsI RAATTY 2 cut(s) 29, 368
AgsI TTSAA 3 cut(s) 35, 368, 374
AjnI CCWGG 1 cut(s) 185
AluBI AGCT 4 cut(s) 116, 183, 305, 316
AluI AGCT 4 cut(s) 116, 183, 305, 316
Alw26I GTCTC 4 cut(s) 127, 141, 164, 187
AlwI GGATC 2 cut(s) 68, 81
AoxI GGCC 2 cut(s) 188, 402
ApeKI GCWGC 3 cut(s) 254, 344, 498
ApoI RAATTY 2 cut(s) 29, 368
ArsI GACNNNNNNTTYG 2 cut(s) 467, 499
AspLEI GCGC 1 cut(s) 247
AsuHPI GGTGA 2 cut(s) 50, 473
BalI TGGCCA 1 cut(s) 404
BamHI GGATCC 1 cut(s) 73
BbvI GCAGC 3 cut(s) 266, 331, 510
BccI CCATC 3 cut(s) 88, 184, 482
BcgI CGANNNNNNTGC 2 cut(s) 90, 124
BciT130I CCWGG 1 cut(s) 187
BciVI GTATCC 1 cut(s) 403
BcoDI GTCTC 4 cut(s) 127, 141, 164, 187
BfaI CTAG 2 cut(s) 117, 317
BfuI GTATCC 1 cut(s) 403
BisI GCNGC 3 cut(s) 255, 345, 499
BlsI GCNGC 3 cut(s) 256, 346, 500
Bme1390I CCNGG 1 cut(s) 187
BmiI GGNNCC 1 cut(s) 75
BmrFI CCNGG 1 cut(s) 187
BmsI GCATC 3 cut(s) 110, 241, 379
BpmI CTGGAG 1 cut(s) 169
BpuEI CTTGAG 1 cut(s) 285
BsaI GGTCTC 1 cut(s) 187
BsaJI CCNNGG 3 cut(s) 216, 285, 405
Bse118I RCCGGY 1 cut(s) 97
BseBI CCWGG 1 cut(s) 187
BseDI CCNNGG 3 cut(s) 216, 285, 405
BseGI GGATG 2 cut(s) 10, 157
BseXI GCAGC 3 cut(s) 266, 331, 510
BshFI GGCC 2 cut(s) 190, 404
BsiSI CCGG 1 cut(s) 98
BslFI GGGAC 1 cut(s) 216
BsmAI GTCTC 4 cut(s) 127, 141, 164, 187
BsmFI GGGAC 1 cut(s) 216
BsnI GGCC 2 cut(s) 190, 404
Bso31I GGTCTC 1 cut(s) 187
Bsp143I GATC 1 cut(s) 73
Bsp19I CCATGG 2 cut(s) 285, 405
BspACI CCGC 1 cut(s) 501
BspANI GGCC 2 cut(s) 190, 404
BspLI GGNNCC 1 cut(s) 75
BspPI GGATC 2 cut(s) 68, 81
BspTNI GGTCTC 1 cut(s) 187
BsrFI RCCGGY 1 cut(s) 97
BssAI RCCGGY 1 cut(s) 97
BssECI CCNNGG 3 cut(s) 216, 285, 405
BssMI GATC 1 cut(s) 73
BssT1I CCWWGG 3 cut(s) 216, 285, 405
Bst2UI CCWGG 1 cut(s) 187
Bst6I CTCTTC 1 cut(s) 369
BstDSI CCRYGG 2 cut(s) 285, 405
BstF5I GGATG 2 cut(s) 10, 157
BstHHI GCGC 1 cut(s) 247
BstKTI GATC 1 cut(s) 76
BstMAI GTCTC 4 cut(s) 127, 141, 164, 187
BstMBI GATC 1 cut(s) 73
BstMWI GCNNNNNNNGC 3 cut(s) 221, 251, 281
BstNI CCWGG 1 cut(s) 187
BstSCI CCNGG 1 cut(s) 185
BstV1I GCAGC 3 cut(s) 266, 331, 510
BstX2I RGATCY 1 cut(s) 73
BstYI RGATCY 1 cut(s) 73
BsuI GTATCC 1 cut(s) 403
BsuRI GGCC 2 cut(s) 190, 404
BtgI CCRYGG 2 cut(s) 285, 405
BtsCI GGATG 2 cut(s) 10, 157
CfoI GCGC 1 cut(s) 247
Cfr10I RCCGGY 1 cut(s) 97
CviAII CATG 3 cut(s) 286, 406, 421
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
EaeI YGGCCR 1 cut(s) 402
Eam1104I CTCTTC 1 cut(s) 369
EarI CTCTTC 1 cut(s) 369
Eco130I CCWWGG 3 cut(s) 216, 285, 405
Eco31I GGTCTC 1 cut(s) 187
Eco32I GATATC 1 cut(s) 466
EcoRII CCWGG 1 cut(s) 185
EcoRV GATATC 1 cut(s) 466
EcoT14I CCWWGG 3 cut(s) 216, 285, 405
ErhI CCWWGG 3 cut(s) 216, 285, 405
FaeI CATG 3 cut(s) 289, 409, 424
FaiI YATR 8 cut(s) 106, 266, 278, 287, 401, 407, 422, 512
FaqI GGGAC 1 cut(s) 216
FatI CATG 3 cut(s) 285, 405, 420
Fnu4HI GCNGC 3 cut(s) 255, 345, 499
FokI GGATG 1 cut(s) 164
Fsp4HI GCNGC 3 cut(s) 255, 345, 499
FspBI CTAG 2 cut(s) 117, 317
GlaI GCGC 1 cut(s) 246
GluI GCNGC 3 cut(s) 255, 345, 499
GsuI CTGGAG 1 cut(s) 169
HaeIII GGCC 2 cut(s) 190, 404
HapII CCGG 1 cut(s) 98
HhaI GCGC 1 cut(s) 247
Hin1II CATG 3 cut(s) 289, 409, 424
Hin6I GCGC 1 cut(s) 245
HinP1I GCGC 1 cut(s) 245
HindIII AAGCTT 1 cut(s) 303
HinfI GANTC 2 cut(s) 134, 293
HpaII CCGG 1 cut(s) 98
HphI GGTGA 2 cut(s) 50, 473
Hpy188I TCNGA 2 cut(s) 127, 487
HpyAV CCTTC 2 cut(s) 235, 352
HpyCH4V TGCA 2 cut(s) 254, 392
HpyF10VI GCNNNNNNNGC 3 cut(s) 221, 251, 281
Hsp92II CATG 3 cut(s) 289, 409, 424
HspAI GCGC 1 cut(s) 245
Kzo9I GATC 1 cut(s) 73
LmnI GCTCC 1 cut(s) 188
LpnPI CCDG 3 cut(s) 111, 172, 199
Lsp1109I GCAGC 3 cut(s) 266, 331, 510
LweI GCATC 3 cut(s) 110, 241, 379
MaeI CTAG 2 cut(s) 117, 317
MaeIII GTNAC 1 cut(s) 503
MalI GATC 1 cut(s) 75
MboI GATC 1 cut(s) 73
MboII GAAGA 4 cut(s) 334, 347, 386, 398
MfeI CAATTG 1 cut(s) 141
MflI RGATCY 1 cut(s) 73
MlsI TGGCCA 1 cut(s) 404
MluCI AATT 7 cut(s) 29, 85, 141, 368, 396, 415, 518
MluNI TGGCCA 1 cut(s) 404
MlyI GAGTC 1 cut(s) 143
MnlI CCTC 2 cut(s) 370, 525
Mox20I TGGCCA 1 cut(s) 404
MscI TGGCCA 1 cut(s) 404
MseI TTAA 2 cut(s) 51, 526
Msp20I TGGCCA 1 cut(s) 404
MspA1I CMGCKG 1 cut(s) 501
MspI CCGG 1 cut(s) 98
MspR9I CCNGG 1 cut(s) 187
MunI CAATTG 1 cut(s) 141
MvaI CCWGG 1 cut(s) 187
MwoI GCNNNNNNNGC 3 cut(s) 221, 251, 281
NcoI CCATGG 2 cut(s) 285, 405
NdeII GATC 1 cut(s) 73
NlaIII CATG 3 cut(s) 289, 409, 424
NlaIV GGNNCC 1 cut(s) 75
NmeAIII GCCGAG 1 cut(s) 216
PfeI GAWTC 1 cut(s) 293
PkrI GCNGC 3 cut(s) 256, 346, 500
PleI GAGTC 1 cut(s) 142
PpsI GAGTC 1 cut(s) 142
Psp6I CCWGG 1 cut(s) 185
PspGI CCWGG 1 cut(s) 185
PspN4I GGNNCC 1 cut(s) 75
PsuI RGATCY 1 cut(s) 73
SaqAI TTAA 2 cut(s) 51, 526
SatI GCNGC 3 cut(s) 255, 345, 499
Sau3AI GATC 1 cut(s) 73
SchI GAGTC 1 cut(s) 143
ScrFI CCNGG 1 cut(s) 187
SetI ASST 6 cut(s) 118, 185, 307, 318, 363, 517
SfaNI GCATC 3 cut(s) 110, 241, 379
SmlI CTYRAG 1 cut(s) 300
SmoI CTYRAG 1 cut(s) 300
Sse9I AATT 7 cut(s) 29, 85, 141, 368, 396, 415, 518
SsiI CCGC 1 cut(s) 501
SspMI CTAG 2 cut(s) 117, 317
StyD4I CCNGG 1 cut(s) 185
StyI CCWWGG 3 cut(s) 216, 285, 405
TaqI TCGA 2 cut(s) 110, 522
TasI AATT 7 cut(s) 29, 85, 141, 368, 396, 415, 518
TfiI GAWTC 1 cut(s) 293
Tru1I TTAA 2 cut(s) 51, 526
Tru9I TTAA 2 cut(s) 51, 526
TseI GCWGC 3 cut(s) 254, 344, 498
TspDTI ATGAA 2 cut(s) 17, 171
XapI RAATTY 2 cut(s) 29, 368
XspI CTAG 2 cut(s) 117, 317
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.