Rh2BG308900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
35972164 .. 35972834
671 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG308900.1

Sequence Viewer

Length: 564 bp
ATGGACAAGTTATATCAAACCCACATGTATTACAAGCGTGCAAATAAGGGTAAGGGTTTCACCTATATTCACTGTTGGGAAGTGGTAAAGGATCACCCAAAGTTCAAGGATCCACCAAAAGGGGTGACACAACCTTCACAGGTAGTTGATGATTCACCAATTCAGTCTACTGACAATGATAAAGAGTGCATCGCCGAGCCATCTGATGAAAGACCTCCAGGAAGAAAGGCTCAAAAGAGAGATGCTAAGCTCAAAAGGAAGATTAGCAAAAAGCAAGATCGATATATTCAAGCAATGGAAAACATTGCATTTAATAGTGAAGCTAGTAGAGAGGCCACAAGAATCAGAGATGAAGAAAACAAAAAGCACATCAAGTGGCAGCAACAAATGGAAGTGGAAAAGCAACAACTAGAACTACAAAAAGTGCAACTAGAAATCCAAAAGGAGGAAAATTGGGTTATGGCTAAAAACGTTAGCATAATGACTCCAGAATCAAAAGCATGGTGGAATAACAGAAAGAAAGCTATCCGTGACAAAACCTCAGATGATTGGGAGGGTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

187

Amino Acids

22.2

Weight (kDa)

9.24

Isoelectric Point (pI)

49.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 18 - 176 7e-14 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 167
AclI AACGTT 1 cut(s) 471
AclWI GGATC 3 cut(s) 99, 104, 117
AfiI CCNNNNNNNGG 2 cut(s) 119, 445
AflIII ACRYGT 1 cut(s) 24
AgsI TTSAA 2 cut(s) 106, 290
AjnI CCWGG 1 cut(s) 217
AluBI AGCT 3 cut(s) 250, 323, 524
AluI AGCT 3 cut(s) 250, 323, 524
AlwI GGATC 3 cut(s) 99, 104, 117
AoxI GGCC 1 cut(s) 333
ApeKI GCWGC 1 cut(s) 379
AsuHPI GGTGA 4 cut(s) 52, 86, 136, 147
BamHI GGATCC 1 cut(s) 109
BbvI GCAGC 1 cut(s) 391
BccI CCATC 1 cut(s) 208
BciT130I CCWGG 1 cut(s) 219
BfaI CTAG 3 cut(s) 324, 410, 431
BisI GCNGC 1 cut(s) 380
BlpI GCTNAGC 1 cut(s) 246
BlsI GCNGC 1 cut(s) 381
Bme1390I CCNGG 1 cut(s) 219
BmiI GGNNCC 1 cut(s) 111
BmrFI CCNGG 1 cut(s) 219
BmsI GCATC 2 cut(s) 198, 232
BpmI CTGGAG 2 cut(s) 201, 471
Bpu1102I GCTNAGC 1 cut(s) 246
Bsa29I ATCGAT 1 cut(s) 280
BsaXI ACNNNNNCTCC 1 cut(s) 545
Bsc4I CCNNNNNNNGG 2 cut(s) 119, 445
Bse3DI GCAATG 2 cut(s) 300, 303
BseBI CCWGG 1 cut(s) 219
BseCI ATCGAT 1 cut(s) 280
BseLI CCNNNNNNNGG 2 cut(s) 119, 445
BseMI GCAATG 2 cut(s) 300, 303
BseMII CTCAG 1 cut(s) 555
BseXI GCAGC 1 cut(s) 391
BshFI GGCC 1 cut(s) 335
BshVI ATCGAT 1 cut(s) 280
BslI CCNNNNNNNGG 2 cut(s) 119, 445
BsnI GGCC 1 cut(s) 335
Bsp143I GATC 3 cut(s) 91, 109, 277
Bsp1720I GCTNAGC 1 cut(s) 246
BspANI GGCC 1 cut(s) 335
BspCNI CTCAG 1 cut(s) 554
BspDI ATCGAT 1 cut(s) 280
BspLI GGNNCC 1 cut(s) 111
BspPI GGATC 3 cut(s) 99, 104, 117
BsrDI GCAATG 2 cut(s) 300, 303
BssMI GATC 3 cut(s) 91, 109, 277
Bst2UI CCWGG 1 cut(s) 219
Bst4CI ACNGT 1 cut(s) 74
BstC8I GCNNGC 1 cut(s) 39
BstDEI CTNAG 2 cut(s) 246, 541
BstKTI GATC 3 cut(s) 94, 112, 280
BstMBI GATC 3 cut(s) 91, 109, 277
BstNI CCWGG 1 cut(s) 219
BstNSI RCATGY 1 cut(s) 28
BstSCI CCNGG 1 cut(s) 217
BstV1I GCAGC 1 cut(s) 391
BstX2I RGATCY 1 cut(s) 109
BstYI RGATCY 1 cut(s) 109
Bsu15I ATCGAT 1 cut(s) 280
BsuRI GGCC 1 cut(s) 335
BsuTUI ATCGAT 1 cut(s) 280
BtgZI GCGATG 1 cut(s) 175
BtsIMutI CAGTG 1 cut(s) 70
Cac8I GCNNGC 1 cut(s) 39
ClaI ATCGAT 1 cut(s) 280
CviAII CATG 2 cut(s) 25, 501
CviJI RGCY 7 cut(s) 199, 230, 250, 323, 335, 464, 524
CviKI_1 RGCY 7 cut(s) 199, 230, 250, 323, 335, 464, 524
DdeI CTNAG 2 cut(s) 246, 541
DpnI GATC 3 cut(s) 93, 111, 279
DpnII GATC 3 cut(s) 91, 109, 277
EcoRII CCWGG 1 cut(s) 217
FaeI CATG 2 cut(s) 28, 504
FaiI YATR 7 cut(s) 13, 26, 66, 285, 461, 479, 502
FatI CATG 2 cut(s) 24, 500
FblI GTMKAC 1 cut(s) 167
Fnu4HI GCNGC 1 cut(s) 380
Fsp4HI GCNGC 1 cut(s) 380
FspBI CTAG 3 cut(s) 324, 410, 431
GluI GCNGC 1 cut(s) 380
GsuI CTGGAG 2 cut(s) 201, 471
HaeIII GGCC 1 cut(s) 335
Hin1II CATG 2 cut(s) 28, 504
HinfI GANTC 4 cut(s) 152, 342, 484, 491
HphI GGTGA 4 cut(s) 52, 86, 136, 147
Hpy166II GTNNAC 1 cut(s) 168
Hpy188I TCNGA 3 cut(s) 205, 347, 544
Hpy188III TCNNGA 1 cut(s) 488
Hpy8I GTNNAC 1 cut(s) 168
HpyAV CCTTC 1 cut(s) 144
HpyCH4III ACNGT 1 cut(s) 74
HpyCH4IV ACGT 1 cut(s) 471
HpyCH4V TGCA 4 cut(s) 41, 189, 308, 427
HpyF3I CTNAG 2 cut(s) 246, 541
HpySE526I ACGT 1 cut(s) 471
Hsp92II CATG 2 cut(s) 28, 504
Kzo9I GATC 3 cut(s) 91, 109, 277
LpnPI CCDG 4 cut(s) 125, 204, 231, 501
Lsp1109I GCAGC 1 cut(s) 391
LweI GCATC 2 cut(s) 198, 232
MaeI CTAG 3 cut(s) 324, 410, 431
MaeII ACGT 1 cut(s) 471
MaeIII GTNAC 2 cut(s) 124, 530
MalI GATC 3 cut(s) 93, 111, 279
MboI GATC 3 cut(s) 91, 109, 277
MboII GAAGA 3 cut(s) 234, 271, 365
MflI RGATCY 1 cut(s) 109
MluCI AATT 2 cut(s) 159, 451
MlyI GAGTC 1 cut(s) 478
MnlI CCTC 5 cut(s) 225, 325, 439, 547, 550
MseI TTAA 1 cut(s) 312
MspR9I CCNGG 1 cut(s) 219
MvaI CCWGG 1 cut(s) 219
NdeII GATC 3 cut(s) 91, 109, 277
NlaIII CATG 2 cut(s) 28, 504
NlaIV GGNNCC 1 cut(s) 111
NmeAIII GCCGAG 1 cut(s) 220
NmuCI GTSAC 2 cut(s) 124, 530
NspI RCATGY 1 cut(s) 28
PciI ACATGT 1 cut(s) 24
PfeI GAWTC 3 cut(s) 152, 342, 491
PfoI TCCNGGA 1 cut(s) 217
PkrI GCNGC 1 cut(s) 381
PleI GAGTC 1 cut(s) 478
PpsI GAGTC 1 cut(s) 478
PscI ACATGT 1 cut(s) 24
Psp1406I AACGTT 1 cut(s) 471
Psp6I CCWGG 1 cut(s) 217
PspGI CCWGG 1 cut(s) 217
PspN4I GGNNCC 1 cut(s) 111
PsuI RGATCY 1 cut(s) 109
SaqAI TTAA 1 cut(s) 312
SatI GCNGC 1 cut(s) 380
Sau3AI GATC 3 cut(s) 91, 109, 277
SchI GAGTC 1 cut(s) 478
ScrFI CCNGG 1 cut(s) 219
SetI ASST 9 cut(s) 65, 136, 144, 217, 252, 325, 474, 526, 542
SfaNI GCATC 2 cut(s) 198, 232
Sse9I AATT 2 cut(s) 159, 451
SspMI CTAG 3 cut(s) 324, 410, 431
StyD4I CCNGG 1 cut(s) 217
TaaI ACNGT 1 cut(s) 74
TaiI ACGT 1 cut(s) 474
TaqI TCGA 1 cut(s) 280
TasI AATT 2 cut(s) 159, 451
TfiI GAWTC 3 cut(s) 152, 342, 491
Tru1I TTAA 1 cut(s) 312
Tru9I TTAA 1 cut(s) 312
TscAI CASTG 1 cut(s) 77
TseFI GTSAC 2 cut(s) 124, 530
TseI GCWGC 1 cut(s) 379
Tsp45I GTSAC 2 cut(s) 124, 530
TspDTI ATGAA 2 cut(s) 222, 366
TspGWI ACGGA 1 cut(s) 518
TspRI CASTG 1 cut(s) 77
XceI RCATGY 1 cut(s) 28
XmiI GTMKAC 1 cut(s) 167
XspI CTAG 3 cut(s) 324, 410, 431
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.