FvH4_4g14180

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0000206
Physical Location & Seq
Forward (+)
17776114 .. 17776641
528 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g14180.t1

Sequence Viewer

Length: 528 bp
ATGAAACATCATCCCAAGGAATTTGATAAGTGGGCTTGTTGGGAGAAAGTTAAGCACCACCCTTATTTTGTTGATCCACCAAGCAAAGAAAGAGCACCAGAATCATTTCCGACACATATTGCCTCCGAAAACGAGTCTCCAATTGACTTGGATGATGATGAAGTTATGGAGACACCACCTAGCTCTTTGCCGAGACCAATGGGACAAAAGAGAGCCAAAGAAGCAATGAGGAAAGGAAAGAAAGTGCAAGATGTTGCTTCAAGTTTGGCTTTTTCTATTCAATCCATGGCCGAGTCAACGCAAGCTTCTGTTGAGCTAGTGAGGCAAAGAAATGAAGAAATTGCCGCTCACTCAAAGAGAGTTATGGAATTAGAAGAGGCGAAAGAGGATTCAAGAATTATGGGCAAGGATACTAGTAATATGTCTCCAGATGAAAAACGTTGGTGGAAACAAAGGAAAAGAAGTGTTATGGCAAAAACTTTGTTTGATGATGGTAGCAGTGATTGCTACACACCTGGGTTTGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

176

Amino Acids

20.12

Weight (kDa)

6.1

Isoelectric Point (pI)

63.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 6 - 155 1.3e-12 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 347
AciI CCGC 1 cut(s) 345
AclI AACGTT 1 cut(s) 439
AclWI GGATC 1 cut(s) 68
AcoI YGGCCR 1 cut(s) 288
AcsI RAATTY 1 cut(s) 20
AgsI TTSAA 3 cut(s) 261, 281, 393
AhlI ACTAGT 1 cut(s) 413
AjnI CCWGG 1 cut(s) 514
AluBI AGCT 3 cut(s) 183, 305, 316
AluI AGCT 3 cut(s) 183, 305, 316
Alw21I GWGCWC 1 cut(s) 97
Alw26I GTCTC 4 cut(s) 141, 164, 187, 429
AlwI GGATC 1 cut(s) 68
AoxI GGCC 1 cut(s) 288
ApoI RAATTY 1 cut(s) 20
Asp700I GAANNNNTTC 1 cut(s) 105
Bbv12I GWGCWC 1 cut(s) 97
BccI CCATC 1 cut(s) 485
BciT130I CCWGG 1 cut(s) 516
BciVI GTATCC 1 cut(s) 403
BcoDI GTCTC 4 cut(s) 141, 164, 187, 429
BcuI ACTAGT 1 cut(s) 413
BfaI CTAG 3 cut(s) 180, 317, 414
BfuI GTATCC 1 cut(s) 403
BisI GCNGC 1 cut(s) 345
BlsI GCNGC 1 cut(s) 346
Bme1390I CCNGG 1 cut(s) 516
BmrFI CCNGG 1 cut(s) 516
BpmI CTGGAG 1 cut(s) 411
BsaI GGTCTC 1 cut(s) 187
BsaJI CCNNGG 3 cut(s) 15, 285, 515
Bse3DI GCAATG 1 cut(s) 231
BseBI CCWGG 1 cut(s) 516
BseDI CCNNGG 3 cut(s) 15, 285, 515
BseGI GGATG 2 cut(s) 10, 157
BseMI GCAATG 1 cut(s) 231
BshFI GGCC 1 cut(s) 290
BsiHKAI GWGCWC 1 cut(s) 97
BslFI GGGAC 1 cut(s) 216
BsmAI GTCTC 4 cut(s) 141, 164, 187, 429
BsmFI GGGAC 1 cut(s) 216
BsnI GGCC 1 cut(s) 290
Bso31I GGTCTC 1 cut(s) 187
Bsp1286I GDGCHC 1 cut(s) 97
Bsp143I GATC 1 cut(s) 73
Bsp19I CCATGG 1 cut(s) 285
BspACI CCGC 1 cut(s) 345
BspANI GGCC 1 cut(s) 290
BspPI GGATC 1 cut(s) 68
BspTNI GGTCTC 1 cut(s) 187
BsrBI CCGCTC 1 cut(s) 347
BsrDI GCAATG 1 cut(s) 231
BssECI CCNNGG 3 cut(s) 15, 285, 515
BssMI GATC 1 cut(s) 73
BssT1I CCWWGG 2 cut(s) 15, 285
Bst2UI CCWGG 1 cut(s) 516
Bst6I CTCTTC 1 cut(s) 369
BstAPI GCANNNNNTGC 1 cut(s) 504
BstC8I GCNNGC 1 cut(s) 303
BstDSI CCRYGG 1 cut(s) 285
BstF5I GGATG 2 cut(s) 10, 157
BstKTI GATC 1 cut(s) 76
BstMAI GTCTC 4 cut(s) 141, 164, 187, 429
BstMBI GATC 1 cut(s) 73
BstMWI GCNNNNNNNGC 3 cut(s) 221, 322, 504
BstNI CCWGG 1 cut(s) 516
BstSCI CCNGG 1 cut(s) 514
BsuI GTATCC 1 cut(s) 403
BsuRI GGCC 1 cut(s) 290
BtgI CCRYGG 1 cut(s) 285
BtsCI GGATG 2 cut(s) 10, 157
BtsI GCAGTG 1 cut(s) 505
BtsIMutI CAGTG 1 cut(s) 505
Cac8I GCNNGC 1 cut(s) 303
CviAII CATG 1 cut(s) 286
CviJI RGCY 7 cut(s) 35, 183, 215, 269, 290, 305, 316
CviKI_1 RGCY 7 cut(s) 35, 183, 215, 269, 290, 305, 316
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
EaeI YGGCCR 1 cut(s) 288
Eam1104I CTCTTC 1 cut(s) 369
EarI CTCTTC 1 cut(s) 369
Eco130I CCWWGG 2 cut(s) 15, 285
Eco31I GGTCTC 1 cut(s) 187
EcoRII CCWGG 1 cut(s) 514
EcoT14I CCWWGG 2 cut(s) 15, 285
ErhI CCWWGG 2 cut(s) 15, 285
FaeI CATG 1 cut(s) 289
FaiI YATR 7 cut(s) 117, 167, 287, 365, 401, 422, 470
FalI AAGNNNNNCTT 2 cut(s) 253, 285
FaqI GGGAC 1 cut(s) 216
FatI CATG 1 cut(s) 285
Fnu4HI GCNGC 1 cut(s) 345
FokI GGATG 1 cut(s) 164
Fsp4HI GCNGC 1 cut(s) 345
FspBI CTAG 3 cut(s) 180, 317, 414
GluI GCNGC 1 cut(s) 345
GsuI CTGGAG 1 cut(s) 411
HaeIII GGCC 1 cut(s) 290
Hin1II CATG 1 cut(s) 289
HincII GTYRAC 1 cut(s) 297
HindII GTYRAC 1 cut(s) 297
HindIII AAGCTT 1 cut(s) 303
HinfI GANTC 4 cut(s) 101, 134, 293, 389
Hpy166II GTNNAC 1 cut(s) 297
Hpy188I TCNGA 2 cut(s) 111, 127
Hpy188III TCNNGA 2 cut(s) 393, 428
Hpy8I GTNNAC 1 cut(s) 297
HpyCH4IV ACGT 1 cut(s) 439
HpyCH4V TGCA 1 cut(s) 247
HpyF10VI GCNNNNNNNGC 3 cut(s) 221, 322, 504
HpySE526I ACGT 1 cut(s) 439
Hsp92II CATG 1 cut(s) 289
Kzo9I GATC 1 cut(s) 73
LpnPI CCDG 3 cut(s) 111, 441, 501
MaeI CTAG 3 cut(s) 180, 317, 414
MaeII ACGT 1 cut(s) 439
MalI GATC 1 cut(s) 75
MbiI CCGCTC 1 cut(s) 347
MboI GATC 1 cut(s) 73
MboII GAAGA 2 cut(s) 347, 386
MfeI CAATTG 1 cut(s) 141
MhlI GDGCHC 1 cut(s) 97
MluCI AATT 5 cut(s) 20, 141, 339, 368, 396
MlyI GAGTC 2 cut(s) 143, 302
MmeI TCCRAC 1 cut(s) 134
MnlI CCTC 5 cut(s) 133, 222, 315, 370, 379
MroXI GAANNNNTTC 1 cut(s) 105
MseI TTAA 1 cut(s) 51
MspR9I CCNGG 1 cut(s) 516
MunI CAATTG 1 cut(s) 141
MvaI CCWGG 1 cut(s) 516
MwoI GCNNNNNNNGC 3 cut(s) 221, 322, 504
NcoI CCATGG 1 cut(s) 285
NdeII GATC 1 cut(s) 73
NlaIII CATG 1 cut(s) 289
NmeAIII GCCGAG 2 cut(s) 216, 316
PdmI GAANNNNTTC 1 cut(s) 105
PfeI GAWTC 2 cut(s) 101, 389
PkrI GCNGC 1 cut(s) 346
PleI GAGTC 2 cut(s) 142, 301
PpsI GAGTC 2 cut(s) 142, 301
Psp1406I AACGTT 1 cut(s) 439
Psp6I CCWGG 1 cut(s) 514
PspGI CCWGG 1 cut(s) 514
SaqAI TTAA 1 cut(s) 51
SatI GCNGC 1 cut(s) 345
Sau3AI GATC 1 cut(s) 73
SchI GAGTC 2 cut(s) 143, 302
ScrFI CCNGG 1 cut(s) 516
SduI GDGCHC 1 cut(s) 97
SetI ASST 6 cut(s) 181, 185, 307, 318, 442, 517
SpeI ACTAGT 1 cut(s) 413
Sse9I AATT 5 cut(s) 20, 141, 339, 368, 396
SsiI CCGC 1 cut(s) 345
SspMI CTAG 3 cut(s) 180, 317, 414
StyD4I CCNGG 1 cut(s) 514
StyI CCWWGG 2 cut(s) 15, 285
TaiI ACGT 1 cut(s) 442
TasI AATT 5 cut(s) 20, 141, 339, 368, 396
TauI GCSGC 1 cut(s) 347
TfiI GAWTC 2 cut(s) 101, 389
Tru1I TTAA 1 cut(s) 51
Tru9I TTAA 1 cut(s) 51
TscAI CASTG 1 cut(s) 505
TspDTI ATGAA 4 cut(s) 17, 174, 348, 447
TspRI CASTG 1 cut(s) 505
XapI RAATTY 1 cut(s) 20
XmnI GAANNNNTTC 1 cut(s) 105
XspI CTAG 3 cut(s) 180, 317, 414
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.