pycom11g12870

Peptidyl-prolyl cis-trans isomerase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
11897710 .. 11898936
1227 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g12870.1

Sequence Viewer

Length: 1002 bp
ATGACTTCGTGGAAGCTCAGTGAAGATGTTACGTTGTGTGAATGTTGGGTTCGCACTACTCATGACCCGATTATGGGTAATGAGATGGATAAGCGAGAAATGTGGAGTAAAATTACGAAATCGTTTTGCGATGTACATGGAAAAGATGCCAGATCTAGTCAAGGTCTTCAAGGTCGTTGGAAAAAACTCAACGCATCCTTTACTTGTTGGAAAAACGCCCTCTCTCATGCTTCTGGTAATCTGCGTAGTGGGACAAGTTTAGCGGATGAGACACTACAAGCACAAGCATTCTACAATGCAAAGAACCATAACAAATCATTCAACAAATGGGAATGTTGGCAAATTGTCAAAGATTGCCCTAGATACAAAATTGTGGCAACCGGTCCAGAAGTTGTCATGCACGGTATGGGTCTACACAGTTCGCCAGAAGCAGACACAGCCGAACAAGAAGCCAACACATTTGAAGACACAGAAGGGACGCCTGAACAAGTGCCAGAGACCCAACCGACTCGTCAGTCCCTCAGGCCTCAAGGTAAAAAGGCATCAAAGAAAAAAGGTAGTACTTCCAAAAATGACTACACTAAATATATGAAGGAACTTACTCGTCAAGGTGAACTGAACATGGCATGGGAAAAGGCTAGAGATGAGGAAAAAGCTGCTGCTATGGCAGCAATTATTGCAGCTACTGAGGCTCGTGATGCGGCGGCTGAGAGACAAAGAGAAATAGTTAATCGAGAGAACGAGATGATTAGAGACGCACTTCATCGAGAGAATGAGATGCTTAGAGAAGAAAGGATGGCTCAAACAGATCGTGACACTATGAACAAGTCTCTAGTAGGACTGTCTCCGAATTCAAAATATTTTTGGACATCAGAAAAAAGAGATGTCGTGCGAAGGAGGCGTGCAAGAGATGCCGAAACAAGTCAAGGGGGTTCCAGCTACAGAAATCCTAGCAACCAAGATCCTAGCACCACATATCCTAACTCCACAGACTTTGTATAA

Protein Analysis

334

Amino Acids

37.98

Weight (kDa)

8.41

Isoelectric Point (pI)

52.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 514
AccI GTMKAC 1 cut(s) 412
AciI CCGC 3 cut(s) 263, 701, 704
AclWI GGATC 1 cut(s) 956
AcsI RAATTY 1 cut(s) 850
AcyI GRCGYC 1 cut(s) 479
AfaI GTAC 2 cut(s) 135, 562
AfiI CCNNNNNNNGG 2 cut(s) 73, 74
AgeI ACCGGT 1 cut(s) 380
AgsI TTSAA 4 cut(s) 170, 322, 464, 855
AluBI AGCT 4 cut(s) 16, 656, 683, 939
AluI AGCT 4 cut(s) 16, 656, 683, 939
Alw26I GTCTC 6 cut(s) 263, 491, 706, 747, 834, 849
AlwI GGATC 1 cut(s) 956
AlwNI CAGNNNCTG 1 cut(s) 686
AoxI GGCC 1 cut(s) 524
ApeKI GCWGC 4 cut(s) 656, 659, 668, 680
ApoI RAATTY 1 cut(s) 850
AsiGI ACCGGT 1 cut(s) 380
AspS9I GGNCC 1 cut(s) 383
AsuHPI GGTGA 1 cut(s) 623
AvaII GGWCC 1 cut(s) 383
AxyI CCTNAGG 1 cut(s) 521
BauI CACGAG 1 cut(s) 693
BbsI GAAGAC 2 cut(s) 158, 471
BbvI GCAGC 4 cut(s) 643, 646, 680, 692
BccI CCATC 2 cut(s) 79, 790
BcoDI GTCTC 6 cut(s) 263, 491, 706, 747, 834, 849
BfaI CTAG 6 cut(s) 156, 360, 639, 833, 951, 966
BfmI CTRYAG 1 cut(s) 940
BglII AGATCT 1 cut(s) 152
BisI GCNGC 6 cut(s) 657, 660, 669, 681, 702, 705
BlsI GCNGC 6 cut(s) 658, 661, 670, 682, 703, 706
BmcAI AGTACT 1 cut(s) 562
Bme18I GGWCC 1 cut(s) 383
BmgT120I GGNCC 1 cut(s) 383
BmiI GGNNCC 1 cut(s) 934
BmsI GCATC 6 cut(s) 136, 203, 551, 688, 768, 901
BpiI GAAGAC 2 cut(s) 158, 471
BpuEI CTTGAG 1 cut(s) 513
BsaHI GRCGYC 1 cut(s) 479
BsaI GGTCTC 1 cut(s) 491
BsaWI WCCGGW 1 cut(s) 380
Bsc4I CCNNNNNNNGG 2 cut(s) 73, 74
Bse118I RCCGGY 1 cut(s) 380
Bse21I CCTNAGG 1 cut(s) 521
BseGI GGATG 3 cut(s) 194, 271, 801
BseLI CCNNNNNNNGG 2 cut(s) 73, 74
BseMII CTCAG 4 cut(s) 31, 535, 678, 699
BseXI GCAGC 4 cut(s) 643, 646, 680, 692
BshFI GGCC 1 cut(s) 526
BshTI ACCGGT 1 cut(s) 380
BsiSI CCGG 1 cut(s) 381
BslFI GGGAC 3 cut(s) 265, 490, 502
BslI CCNNNNNNNGG 2 cut(s) 73, 74
BsmAI GTCTC 6 cut(s) 263, 491, 706, 747, 834, 849
BsmBI CGTCTC 1 cut(s) 747
BsmFI GGGAC 3 cut(s) 265, 490, 502
BsmI GAATGC 1 cut(s) 287
BsnI GGCC 1 cut(s) 526
Bso31I GGTCTC 1 cut(s) 491
Bsp1407I TGTACA 1 cut(s) 133
Bsp143I GATC 3 cut(s) 152, 808, 961
BspACI CCGC 3 cut(s) 263, 701, 704
BspANI GGCC 1 cut(s) 526
BspCNI CTCAG 4 cut(s) 30, 534, 679, 700
BspHI TCATGA 1 cut(s) 61
BspLI GGNNCC 1 cut(s) 934
BspPI GGATC 1 cut(s) 956
BspTNI GGTCTC 1 cut(s) 491
BsrFI RCCGGY 1 cut(s) 380
BsrGI TGTACA 1 cut(s) 133
BssAI RCCGGY 1 cut(s) 380
BssMI GATC 3 cut(s) 152, 808, 961
BssNI GRCGYC 1 cut(s) 479
BssSI CACGAG 1 cut(s) 693
Bst2BI CACGAG 1 cut(s) 693
Bst4CI ACNGT 3 cut(s) 404, 419, 843
BstACI GRCGYC 1 cut(s) 479
BstAPI GCANNNNNTGC 2 cut(s) 677, 911
BstAUI TGTACA 1 cut(s) 133
BstC8I GCNNGC 1 cut(s) 903
BstDEI CTNAG 5 cut(s) 17, 521, 687, 708, 782
BstF5I GGATG 3 cut(s) 194, 271, 801
BstKTI GATC 3 cut(s) 155, 811, 964
BstMAI GTCTC 6 cut(s) 263, 491, 706, 747, 834, 849
BstMBI GATC 3 cut(s) 152, 808, 961
BstMWI GCNNNNNNNGC 8 cut(s) 437, 665, 668, 677, 689, 698, 898, 911
BstSFI CTRYAG 1 cut(s) 940
BstV1I GCAGC 4 cut(s) 643, 646, 680, 692
BstV2I GAAGAC 2 cut(s) 158, 471
BstX2I RGATCY 2 cut(s) 152, 961
BstYI RGATCY 2 cut(s) 152, 961
Bsu36I CCTNAGG 1 cut(s) 521
BsuRI GGCC 1 cut(s) 526
BtgZI GCGATG 1 cut(s) 144
BtsCI GGATG 3 cut(s) 194, 271, 801
BtsIMutI CAGTG 1 cut(s) 25
Cac8I GCNNGC 1 cut(s) 903
CaiI CAGNNNCTG 1 cut(s) 686
CciI TCATGA 1 cut(s) 61
Cfr10I RCCGGY 1 cut(s) 380
Cfr13I GGNCC 1 cut(s) 383
CseI GACGC 2 cut(s) 487, 764
Csp6I GTAC 2 cut(s) 134, 561
CspAI ACCGGT 1 cut(s) 380
CspCI CAANNNNNGTGG 1 cut(s) 976
CviAII CATG 6 cut(s) 62, 137, 227, 397, 622, 627
CviQI GTAC 2 cut(s) 134, 561
DdeI CTNAG 5 cut(s) 17, 521, 687, 708, 782
DpnI GATC 3 cut(s) 154, 810, 963
DpnII GATC 3 cut(s) 152, 808, 961
DrdI GACNNNNNNGTC 1 cut(s) 514
DseDI GACNNNNNNGTC 1 cut(s) 514
Eco147I AGGCCT 1 cut(s) 526
Eco31I GGTCTC 1 cut(s) 491
Eco47I GGWCC 1 cut(s) 383
Eco81I CCTNAGG 1 cut(s) 521
EcoRI GAATTC 1 cut(s) 850
Esp3I CGTCTC 1 cut(s) 747
FaeI CATG 6 cut(s) 65, 140, 230, 400, 625, 630
FaqI GGGAC 3 cut(s) 265, 490, 502
FatI CATG 6 cut(s) 61, 136, 226, 396, 621, 626
FblI GTMKAC 1 cut(s) 412
Fnu4HI GCNGC 6 cut(s) 657, 660, 669, 681, 702, 705
FokI GGATG 3 cut(s) 181, 278, 808
Fsp4HI GCNGC 6 cut(s) 657, 660, 669, 681, 702, 705
FspBI CTAG 6 cut(s) 156, 360, 639, 833, 951, 966
GluI GCNGC 6 cut(s) 657, 660, 669, 681, 702, 705
HaeIII GGCC 1 cut(s) 526
HapII CCGG 1 cut(s) 381
HgaI GACGC 2 cut(s) 487, 764
Hin1I GRCGYC 1 cut(s) 479
Hin1II CATG 6 cut(s) 65, 140, 230, 400, 625, 630
HinfI GANTC 1 cut(s) 508
HpaII CCGG 1 cut(s) 381
HphI GGTGA 1 cut(s) 623
Hpy166II GTNNAC 2 cut(s) 413, 614
Hpy188I TCNGA 2 cut(s) 849, 874
Hpy188III TCNNGA 6 cut(s) 62, 386, 695, 734, 767, 812
Hpy8I GTNNAC 2 cut(s) 413, 614
HpyAV CCTTC 3 cut(s) 467, 586, 888
HpyCH4III ACNGT 3 cut(s) 404, 419, 843
HpyCH4IV ACGT 1 cut(s) 32
HpyCH4V TGCA 4 cut(s) 299, 400, 680, 905
HpyF10VI GCNNNNNNNGC 8 cut(s) 437, 665, 668, 677, 689, 698, 898, 911
HpyF3I CTNAG 5 cut(s) 17, 521, 687, 708, 782
HpySE526I ACGT 1 cut(s) 32
Hsp92I GRCGYC 1 cut(s) 479
Hsp92II CATG 6 cut(s) 65, 140, 230, 400, 625, 630
Kzo9I GATC 3 cut(s) 152, 808, 961
LpnPI CCDG 9 cut(s) 163, 219, 394, 399, 438, 495, 507, 508, 949
Lsp1109I GCAGC 4 cut(s) 643, 646, 680, 692
LweI GCATC 6 cut(s) 136, 203, 551, 688, 768, 901
MaeI CTAG 6 cut(s) 156, 360, 639, 833, 951, 966
MaeII ACGT 1 cut(s) 32
MaeIII GTNAC 2 cut(s) 28, 812
MalI GATC 3 cut(s) 154, 810, 963
MboI GATC 3 cut(s) 152, 808, 961
MboII GAAGA 4 cut(s) 35, 158, 476, 800
MflI RGATCY 2 cut(s) 152, 961
MluCI AATT 5 cut(s) 111, 342, 369, 672, 850
MlyI GAGTC 1 cut(s) 502
MmeI TCCRAC 2 cut(s) 158, 188
MnlI CCTC 6 cut(s) 230, 530, 537, 640, 682, 891
MseI TTAA 1 cut(s) 729
MspI CCGG 1 cut(s) 381
Mva1269I GAATGC 1 cut(s) 287
MwoI GCNNNNNNNGC 8 cut(s) 437, 665, 668, 677, 689, 698, 898, 911
NdeII GATC 3 cut(s) 152, 808, 961
NlaIII CATG 6 cut(s) 65, 140, 230, 400, 625, 630
NlaIV GGNNCC 1 cut(s) 934
NmuCI GTSAC 1 cut(s) 812
PagI TCATGA 1 cut(s) 61
PceI AGGCCT 1 cut(s) 526
PctI GAATGC 1 cut(s) 287
PinAI ACCGGT 1 cut(s) 380
PkrI GCNGC 6 cut(s) 658, 661, 670, 682, 703, 706
PleI GAGTC 1 cut(s) 502
PpsI GAGTC 1 cut(s) 502
PspN4I GGNNCC 1 cut(s) 934
PspPI GGNCC 1 cut(s) 383
PstNI CAGNNNCTG 1 cut(s) 686
PsuI RGATCY 2 cut(s) 152, 961
RsaI GTAC 2 cut(s) 135, 562
RsaNI GTAC 2 cut(s) 134, 561
SaqAI TTAA 1 cut(s) 729
SatI GCNGC 6 cut(s) 657, 660, 669, 681, 702, 705
Sau3AI GATC 3 cut(s) 152, 808, 961
Sau96I GGNCC 1 cut(s) 383
ScaI AGTACT 1 cut(s) 562
SchI GAGTC 1 cut(s) 502
SfaNI GCATC 6 cut(s) 136, 203, 551, 688, 768, 901
SfcI CTRYAG 1 cut(s) 940
SinI GGWCC 1 cut(s) 383
SmlI CTYRAG 1 cut(s) 528
SmoI CTYRAG 1 cut(s) 528
Sse9I AATT 5 cut(s) 111, 342, 369, 672, 850
SseBI AGGCCT 1 cut(s) 526
SsiI CCGC 3 cut(s) 263, 701, 704
SspI AATATT 1 cut(s) 860
SspMI CTAG 6 cut(s) 156, 360, 639, 833, 951, 966
StuI AGGCCT 1 cut(s) 526
TaaI ACNGT 3 cut(s) 404, 419, 843
TaiI ACGT 1 cut(s) 35
TaqI TCGA 2 cut(s) 733, 766
TasI AATT 5 cut(s) 111, 342, 369, 672, 850
TatI WGTACW 2 cut(s) 133, 560
TauI GCSGC 2 cut(s) 704, 707
Tru1I TTAA 1 cut(s) 729
Tru9I TTAA 1 cut(s) 729
TscAI CASTG 1 cut(s) 25
TseFI GTSAC 1 cut(s) 812
TseI GCWGC 4 cut(s) 656, 659, 668, 680
Tsp45I GTSAC 1 cut(s) 812
TspDTI ATGAA 3 cut(s) 605, 752, 836
TspRI CASTG 1 cut(s) 25
VpaK11BI GGWCC 1 cut(s) 383
XapI RAATTY 1 cut(s) 850
XmiI GTMKAC 1 cut(s) 412
XspI CTAG 6 cut(s) 156, 360, 639, 833, 951, 966
ZrmI AGTACT 1 cut(s) 562
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.