RLG00000030820

No apical meristem-associated C-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Forward (+)
68091891 .. 68092745
855 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000030820

Sequence Viewer

Length: 690 bp
ATGTCAAATTCAAAGTCAGGCACGAAGTGGGCAATTGATGAGGAAGTGCAATTATGCAAGTCTTGGGCAACTATTACTTCATGTGTTTCTGTAGGAAAGGATCAAGATGCCAAGCATCTATGGCGTAATATTCATGCTCACTACGAACAAAATTGGGAAGGTGATCTGGATGAAGTTCGATCCCATCAAGCACTCGAAAGTAGTTGGCATGATGCGGTGAGCAAAGCGGAGCACTATCATGAGAGCGGCTTGAACAACATGGACAAGTTATATCAAACCCACATGTATTACAAGCGTGCAAATACGGGTAAGGGTTTCACCTATATTCACTATTGGGAAGTGGTAAAGGATCACCCAAAGTTCAAGGATCCACCAAAAGGGGTGACACAACCTTCACAGTCTACTGACAACGATGAAGAGTGCATCGCCGAGCCATCTGATGAAAGACCTTTGGGAAGAAAGGCTCAAAAGAGAGATGCTAAGCTCAAAGAGAAGATTAGCGAAAAGCGAGATCGATATATTCAAGCAATGGAAAACATTGCATTTAATAGTGAAGCTAGTAGAGAGGCCACAAGAATCAGAGATGAAGAAAATAGAAAGCACATCGAGTGGCAGCAACAAATGGAAGTGGAAAAGCAACAACTAGAACTACAAAAAGTGCAACTAGAAATCCAAAAGGAGGAAAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

230

Amino Acids

26.99

Weight (kDa)

5.91

Isoelectric Point (pI)

54.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 246
AccI GTMKAC 1 cut(s) 401
AciI CCGC 3 cut(s) 215, 227, 246
AclWI GGATC 5 cut(s) 108, 174, 357, 362, 375
AcsI RAATTY 1 cut(s) 7
AdeI CACNNNGTG 1 cut(s) 27
AfiI CCNNNNNNNGG 2 cut(s) 377, 679
AflIII ACRYGT 1 cut(s) 282
AgsI TTSAA 4 cut(s) 12, 253, 364, 524
AluBI AGCT 2 cut(s) 484, 557
AluI AGCT 2 cut(s) 484, 557
Alw21I GWGCWC 1 cut(s) 234
AlwI GGATC 5 cut(s) 108, 174, 357, 362, 375
AoxI GGCC 1 cut(s) 567
ApeKI GCWGC 1 cut(s) 613
ApoI RAATTY 1 cut(s) 7
ArsI GACNNNNNNTTYG 1 cut(s) 31
AsuHPI GGTGA 5 cut(s) 173, 229, 310, 344, 394
BamHI GGATCC 1 cut(s) 367
Bbv12I GWGCWC 1 cut(s) 234
BbvI GCAGC 1 cut(s) 625
BccI CCATC 2 cut(s) 192, 442
BfaI CTAG 3 cut(s) 558, 644, 665
BfmI CTRYAG 1 cut(s) 90
BisI GCNGC 2 cut(s) 247, 614
BlpI GCTNAGC 1 cut(s) 480
BlsI GCNGC 2 cut(s) 248, 615
BmiI GGNNCC 1 cut(s) 369
BmsI GCATC 5 cut(s) 97, 124, 202, 432, 466
Bpu1102I GCTNAGC 1 cut(s) 480
Bsa29I ATCGAT 1 cut(s) 514
Bsc4I CCNNNNNNNGG 2 cut(s) 377, 679
Bse3DI GCAATG 2 cut(s) 534, 537
BseCI ATCGAT 1 cut(s) 514
BseGI GGATG 1 cut(s) 175
BseLI CCNNNNNNNGG 2 cut(s) 377, 679
BseMI GCAATG 2 cut(s) 534, 537
BseXI GCAGC 1 cut(s) 625
BshFI GGCC 1 cut(s) 569
BshVI ATCGAT 1 cut(s) 514
BsiHKAI GWGCWC 1 cut(s) 234
BslI CCNNNNNNNGG 2 cut(s) 377, 679
BsnI GGCC 1 cut(s) 569
Bsp1286I GDGCHC 1 cut(s) 234
Bsp143I GATC 6 cut(s) 100, 163, 179, 349, 367, 511
Bsp1720I GCTNAGC 1 cut(s) 480
BspACI CCGC 3 cut(s) 215, 227, 246
BspANI GGCC 1 cut(s) 569
BspDI ATCGAT 1 cut(s) 514
BspHI TCATGA 1 cut(s) 238
BspLI GGNNCC 1 cut(s) 369
BspPI GGATC 5 cut(s) 108, 174, 357, 362, 375
BsrBI CCGCTC 1 cut(s) 246
BsrDI GCAATG 2 cut(s) 534, 537
BssMI GATC 6 cut(s) 100, 163, 179, 349, 367, 511
Bst4CI ACNGT 1 cut(s) 399
Bst6I CTCTTC 1 cut(s) 411
BstC8I GCNNGC 1 cut(s) 297
BstDEI CTNAG 1 cut(s) 480
BstF5I GGATG 1 cut(s) 175
BstKTI GATC 6 cut(s) 103, 166, 182, 352, 370, 514
BstMBI GATC 6 cut(s) 100, 163, 179, 349, 367, 511
BstMWI GCNNNNNNNGC 1 cut(s) 121
BstNSI RCATGY 1 cut(s) 286
BstSFI CTRYAG 1 cut(s) 90
BstV1I GCAGC 1 cut(s) 625
BstX2I RGATCY 1 cut(s) 367
BstYI RGATCY 1 cut(s) 367
Bsu15I ATCGAT 1 cut(s) 514
BsuRI GGCC 1 cut(s) 569
BsuTUI ATCGAT 1 cut(s) 514
BtgZI GCGATG 1 cut(s) 409
BtsCI GGATG 1 cut(s) 175
Cac8I GCNNGC 1 cut(s) 297
CciI TCATGA 1 cut(s) 238
ClaI ATCGAT 1 cut(s) 514
CviAII CATG 6 cut(s) 81, 134, 209, 239, 259, 283
CviJI RGCY 6 cut(s) 249, 433, 464, 484, 557, 569
CviKI_1 RGCY 6 cut(s) 249, 433, 464, 484, 557, 569
DdeI CTNAG 1 cut(s) 480
DpnI GATC 6 cut(s) 102, 165, 181, 351, 369, 513
DpnII GATC 6 cut(s) 100, 163, 179, 349, 367, 511
DraIII CACNNNGTG 1 cut(s) 27
Eam1104I CTCTTC 1 cut(s) 411
EarI CTCTTC 1 cut(s) 411
FaeI CATG 6 cut(s) 84, 137, 212, 242, 262, 286
FatI CATG 6 cut(s) 80, 133, 208, 238, 258, 282
FblI GTMKAC 1 cut(s) 401
Fnu4HI GCNGC 2 cut(s) 247, 614
FokI GGATG 1 cut(s) 182
Fsp4HI GCNGC 2 cut(s) 247, 614
FspBI CTAG 3 cut(s) 558, 644, 665
GluI GCNGC 2 cut(s) 247, 614
HaeIII GGCC 1 cut(s) 569
Hin1II CATG 6 cut(s) 84, 137, 212, 242, 262, 286
HinfI GANTC 1 cut(s) 576
HphI GGTGA 5 cut(s) 173, 229, 310, 344, 394
Hpy166II GTNNAC 1 cut(s) 402
Hpy188I TCNGA 2 cut(s) 439, 581
Hpy188III TCNNGA 3 cut(s) 104, 167, 239
Hpy8I GTNNAC 1 cut(s) 402
HpyAV CCTTC 2 cut(s) 152, 402
HpyCH4III ACNGT 1 cut(s) 399
HpyCH4V TGCA 6 cut(s) 49, 57, 299, 423, 542, 661
HpyF10VI GCNNNNNNNGC 1 cut(s) 121
HpyF3I CTNAG 1 cut(s) 480
Hsp92II CATG 6 cut(s) 84, 137, 212, 242, 262, 286
Kzo9I GATC 6 cut(s) 100, 163, 179, 349, 367, 511
LmnI GCTCC 1 cut(s) 229
LpnPI CCDG 2 cut(s) 3, 152
Lsp1109I GCAGC 1 cut(s) 625
LweI GCATC 5 cut(s) 97, 124, 202, 432, 466
MaeI CTAG 3 cut(s) 558, 644, 665
MaeIII GTNAC 1 cut(s) 382
MalI GATC 6 cut(s) 102, 165, 181, 351, 369, 513
MbiI CCGCTC 1 cut(s) 246
MboI GATC 6 cut(s) 100, 163, 179, 349, 367, 511
MboII GAAGA 4 cut(s) 428, 468, 505, 599
MfeI CAATTG 1 cut(s) 33
MflI RGATCY 1 cut(s) 367
MhlI GDGCHC 1 cut(s) 234
MluCI AATT 5 cut(s) 7, 33, 50, 151, 685
MnlI CCTC 3 cut(s) 34, 559, 673
MseI TTAA 1 cut(s) 546
MslI CAYNNNNRTG 1 cut(s) 237
MunI CAATTG 1 cut(s) 33
MwoI GCNNNNNNNGC 1 cut(s) 121
NdeII GATC 6 cut(s) 100, 163, 179, 349, 367, 511
NlaIII CATG 6 cut(s) 84, 137, 212, 242, 262, 286
NlaIV GGNNCC 1 cut(s) 369
NmeAIII GCCGAG 1 cut(s) 454
NmuCI GTSAC 1 cut(s) 382
NspI RCATGY 1 cut(s) 286
PagI TCATGA 1 cut(s) 238
PciI ACATGT 1 cut(s) 282
PfeI GAWTC 1 cut(s) 576
PkrI GCNGC 2 cut(s) 248, 615
PscI ACATGT 1 cut(s) 282
PspN4I GGNNCC 1 cut(s) 369
PsuI RGATCY 1 cut(s) 367
RseI CAYNNNNRTG 1 cut(s) 237
SaqAI TTAA 1 cut(s) 546
SatI GCNGC 2 cut(s) 247, 614
Sau3AI GATC 6 cut(s) 100, 163, 179, 349, 367, 511
SduI GDGCHC 1 cut(s) 234
SetI ASST 6 cut(s) 163, 323, 394, 451, 486, 559
SfaNI GCATC 5 cut(s) 97, 124, 202, 432, 466
SfcI CTRYAG 1 cut(s) 90
SmiMI CAYNNNNRTG 1 cut(s) 237
Sse9I AATT 5 cut(s) 7, 33, 50, 151, 685
SsiI CCGC 3 cut(s) 215, 227, 246
SspI AATATT 1 cut(s) 130
SspMI CTAG 3 cut(s) 558, 644, 665
TaaI ACNGT 1 cut(s) 399
TaqI TCGA 4 cut(s) 178, 195, 514, 606
TasI AATT 5 cut(s) 7, 33, 50, 151, 685
TauI GCSGC 1 cut(s) 249
TfiI GAWTC 1 cut(s) 576
Tru1I TTAA 1 cut(s) 546
Tru9I TTAA 1 cut(s) 546
TseFI GTSAC 1 cut(s) 382
TseI GCWGC 1 cut(s) 613
Tsp45I GTSAC 1 cut(s) 382
TspDTI ATGAA 6 cut(s) 69, 122, 186, 429, 456, 600
XapI RAATTY 1 cut(s) 7
XceI RCATGY 1 cut(s) 286
XmiI GTMKAC 1 cut(s) 401
XspI CTAG 3 cut(s) 558, 644, 665
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.