Rroxscaffold_7G00176580

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
16173521 .. 16176493
2973 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00176580.1

Sequence Viewer

Length: 270 bp
ATGGAGAACACTGCATTTAATAGTGAAGCTAGTAGAGAGGCCACAAGAATCAGAGATGAAGAAAATAGAAAGCACATCGAGTGGCAGCAACAAATGGAAGTGGAAAAGCAACAACTAGAACTACAAAAAGTGCAACTAGAAATCCAAAAGGAGGAAAATTGGGTTATGGCTAAAGACGTTAGCATAATGACTCCAGAATCAAAAGCATGGTGGAAGAAAAGAAAGAAAGCTATCCGTGACAAAACCTCAGATGATTGGGAGGGTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.81

Weight (kDa)

5.51

Isoelectric Point (pI)

48.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 151
AluBI AGCT 2 cut(s) 29, 230
AluI AGCT 2 cut(s) 29, 230
AoxI GGCC 1 cut(s) 39
ApeKI GCWGC 1 cut(s) 85
BbvI GCAGC 1 cut(s) 97
BfaI CTAG 3 cut(s) 30, 116, 137
BisI GCNGC 1 cut(s) 86
BlsI GCNGC 1 cut(s) 87
BpmI CTGGAG 1 cut(s) 177
BsaXI ACNNNNNCTCC 1 cut(s) 251
Bsc4I CCNNNNNNNGG 1 cut(s) 151
BseLI CCNNNNNNNGG 1 cut(s) 151
BseMII CTCAG 1 cut(s) 261
BseXI GCAGC 1 cut(s) 97
BshFI GGCC 1 cut(s) 41
BslI CCNNNNNNNGG 1 cut(s) 151
BsnI GGCC 1 cut(s) 41
BspANI GGCC 1 cut(s) 41
BspCNI CTCAG 1 cut(s) 260
BstDEI CTNAG 1 cut(s) 247
BstV1I GCAGC 1 cut(s) 97
BsuRI GGCC 1 cut(s) 41
BtsI GCAGTG 1 cut(s) 9
BtsIMutI CAGTG 1 cut(s) 9
CviAII CATG 1 cut(s) 207
CviJI RGCY 4 cut(s) 29, 41, 170, 230
CviKI_1 RGCY 4 cut(s) 29, 41, 170, 230
DdeI CTNAG 1 cut(s) 247
FaeI CATG 1 cut(s) 210
FaiI YATR 3 cut(s) 167, 185, 208
FatI CATG 1 cut(s) 206
Fnu4HI GCNGC 1 cut(s) 86
Fsp4HI GCNGC 1 cut(s) 86
FspBI CTAG 3 cut(s) 30, 116, 137
GluI GCNGC 1 cut(s) 86
GsuI CTGGAG 1 cut(s) 177
HaeIII GGCC 1 cut(s) 41
Hin1II CATG 1 cut(s) 210
HinfI GANTC 3 cut(s) 48, 190, 197
Hpy188I TCNGA 2 cut(s) 53, 250
Hpy188III TCNNGA 1 cut(s) 194
HpyCH4IV ACGT 1 cut(s) 177
HpyCH4V TGCA 2 cut(s) 14, 133
HpyF3I CTNAG 1 cut(s) 247
HpySE526I ACGT 1 cut(s) 177
Hsp92II CATG 1 cut(s) 210
LpnPI CCDG 1 cut(s) 207
Lsp1109I GCAGC 1 cut(s) 97
MaeI CTAG 3 cut(s) 30, 116, 137
MaeII ACGT 1 cut(s) 177
MaeIII GTNAC 1 cut(s) 236
MboII GAAGA 2 cut(s) 71, 226
MluCI AATT 1 cut(s) 157
MlyI GAGTC 1 cut(s) 184
MnlI CCTC 4 cut(s) 31, 145, 253, 256
MseI TTAA 1 cut(s) 18
NlaIII CATG 1 cut(s) 210
NmuCI GTSAC 1 cut(s) 236
PfeI GAWTC 2 cut(s) 48, 197
PkrI GCNGC 1 cut(s) 87
PleI GAGTC 1 cut(s) 184
PpsI GAGTC 1 cut(s) 184
SaqAI TTAA 1 cut(s) 18
SatI GCNGC 1 cut(s) 86
SchI GAGTC 1 cut(s) 184
SetI ASST 4 cut(s) 31, 180, 232, 248
SgeI CNNG 8 cut(s) 42, 57, 91, 128, 149, 206, 219, 248
Sse9I AATT 1 cut(s) 157
SspMI CTAG 3 cut(s) 30, 116, 137
TaiI ACGT 1 cut(s) 180
TaqI TCGA 1 cut(s) 78
TasI AATT 1 cut(s) 157
TfiI GAWTC 2 cut(s) 48, 197
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
TscAI CASTG 1 cut(s) 16
TseFI GTSAC 1 cut(s) 236
TseI GCWGC 1 cut(s) 85
Tsp45I GTSAC 1 cut(s) 236
TspDTI ATGAA 1 cut(s) 72
TspGWI ACGGA 1 cut(s) 224
TspRI CASTG 1 cut(s) 16
XspI CTAG 3 cut(s) 30, 116, 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.