Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010621.1

Orthogroup ID

OG0000206

Physical Location & Seq

Genomic Coordinates Reverse (-)

4896 .. 5872

Gene Structure 977 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010621.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 840 bp

atgggagcttcgggtactaattggcaagtcgaggagcaaattcaattgtgcgattcatgggcgcgtaagacggtatgtccgatcacgggcaaacacataacttcctcaaagttatgggaaaaagttcatgctgattatgtgcaaaattggcaaggtccaccaacaagccgaactcctcaagctctccaatctcagtttcgaacattgaaaagaattctcaaagattggcacaatgcacaaatgacttctcgtaattgtataatgagcggaaccaataaaatggatgaggaaaatcaaactcacgatatcttcatgaaaaaacatcccaagaagtttgataaatttgaatgttgggagaaagttaagtatcacccttattttgtggatccaccatctaattctcaaccaccggcatcatattcgacaactagtgtctccgaaagcgagtctccaattgacttggatgatgaaatagttttggagacaccatcaacctccatgccgagaccaatgggacaaaagagagccaaggaagcaaagaagaaaggaaagaaggcgcaagatgcagcagaaagtatggctcttgctattcaagccatggcagaatcaactcaagcttctgttgagctagtgaagaaaagaaacgaagaaatggctgctcacacaaagaaggtatttgaatttgaagaggcgaaagaagatgcaagaattatggccatggatactaattccatgacaccacaatcaaaggcttggtggaaaaagaaaaagggtgatatcgtagcaaaaacaatgtccgatggtggtagcagcggttgctacatacctcaattcgattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000413 GO:0003674 GO:0003755 GO:0003824 GO:0005488 GO:0005515 GO:0005516 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006807 GO:0007275 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016853 GO:0016859 GO:0018193 GO:0018208 GO:0019538 GO:0032501 GO:0032502 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0048366 GO:0048367 GO:0048731 GO:0048827 GO:0048856 GO:0071704 GO:0071944 GO:0099402 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FKBP_C TPR_2 TPR_8

Protein Analysis

279

Amino Acids

31.65

Weight (kDa)

8.63

Isoelectric Point (pI)

50.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000206)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica	MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis	pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis	RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata	RLG00000030820
rosa_multiflora	Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii	Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa	Rorug03G0276400 Rorug03G0276400
rosa_samantha	Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana	Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	267
AccII	CGCG	1 cut(s)	64
AciI	CCGC	2 cut(s)	267, 813
AclWI	GGATC	2 cut(s)	380, 393
AcoI	YGGCCR	1 cut(s)	714
AcsI	RAATTY	4 cut(s)	39, 213, 341, 680
AfaI	GTAC	1 cut(s)	16
AfiI	CCNNNNNNNGG	1 cut(s)	86
AgsI	TTSAA	6 cut(s)	44, 208, 347, 593, 680, 686
AhdI	GACNNNNNGTC	1 cut(s)	75
AhlI	ACTAGT	1 cut(s)	428
AjuI	GAANNNNNNNTTGG	2 cut(s)	180, 212
AluBI	AGCT	4 cut(s)	8, 182, 617, 628
AluI	AGCT	4 cut(s)	8, 182, 617, 628
Alw26I	GTCTC	4 cut(s)	439, 453, 476, 499
AlwI	GGATC	2 cut(s)	380, 393
AoxI	GGCC	1 cut(s)	714
ApeKI	GCWGC	3 cut(s)	566, 656, 810
ApoI	RAATTY	4 cut(s)	39, 213, 341, 680
ArsI	GACNNNNNNTTYG	2 cut(s)	779, 811
Asp700I	GAANNNNTTC	1 cut(s)	123
AspLEI	GCGC	2 cut(s)	64, 559
AspS9I	GGNCC	1 cut(s)	155
AsuHPI	GGTGA	2 cut(s)	362, 785
AsuII	TTCGAA	1 cut(s)	199
AvaII	GGWCC	1 cut(s)	155
BalI	TGGCCA	1 cut(s)	716
BamHI	GGATCC	1 cut(s)	385
BbvI	GCAGC	3 cut(s)	578, 643, 822
BccI	CCATC	3 cut(s)	400, 496, 794
BcgI	CGANNNNNNTGC	2 cut(s)	402, 436
BciVI	GTATCC	1 cut(s)	715
BcoDI	GTCTC	4 cut(s)	439, 453, 476, 499
BcuI	ACTAGT	1 cut(s)	428
BfaI	CTAG	2 cut(s)	429, 629
BfuI	GTATCC	1 cut(s)	715
BisI	GCNGC	3 cut(s)	567, 657, 811
BlsI	GCNGC	3 cut(s)	568, 658, 812
Bme18I	GGWCC	1 cut(s)	155
BmeRI	GACNNNNNGTC	1 cut(s)	75
BmgT120I	GGNCC	1 cut(s)	155
BmiI	GGNNCC	2 cut(s)	271, 387
BmsI	GCATC	3 cut(s)	422, 553, 691
Bpu14I	TTCGAA	1 cut(s)	199
BpuEI	CTTGAG	2 cut(s)	162, 597
BsaI	GGTCTC	1 cut(s)	499
BsaJI	CCNNGG	3 cut(s)	528, 597, 717
Bsc4I	CCNNNNNNNGG	1 cut(s)	86
Bse118I	RCCGGY	1 cut(s)	409
BseDI	CCNNGG	3 cut(s)	528, 597, 717
BseGI	GGATG	3 cut(s)	289, 322, 469
BseLI	CCNNNNNNNGG	1 cut(s)	86
BseMII	CTCAG	1 cut(s)	206
BseRI	GAGGAG	2 cut(s)	47, 165
BseXI	GCAGC	3 cut(s)	578, 643, 822
Bsh1236I	CGCG	1 cut(s)	64
BshFI	GGCC	1 cut(s)	716
BsiSI	CCGG	1 cut(s)	410
BslFI	GGGAC	1 cut(s)	528
BslI	CCNNNNNNNGG	1 cut(s)	86
BsmAI	GTCTC	4 cut(s)	439, 453, 476, 499
BsmFI	GGGAC	1 cut(s)	528
BsnI	GGCC	1 cut(s)	716
Bso31I	GGTCTC	1 cut(s)	499
Bsp119I	TTCGAA	1 cut(s)	199
Bsp143I	GATC	2 cut(s)	81, 385
Bsp19I	CCATGG	2 cut(s)	597, 717
BspACI	CCGC	2 cut(s)	267, 813
BspANI	GGCC	1 cut(s)	716
BspCNI	CTCAG	1 cut(s)	205
BspFNI	CGCG	1 cut(s)	64
BspHI	TCATGA	1 cut(s)	312
BspLI	GGNNCC	2 cut(s)	271, 387
BspPI	GGATC	2 cut(s)	380, 393
BspT104I	TTCGAA	1 cut(s)	199
BspTNI	GGTCTC	1 cut(s)	499
BsrBI	CCGCTC	1 cut(s)	267
BsrFI	RCCGGY	1 cut(s)	409
BssAI	RCCGGY	1 cut(s)	409
BssECI	CCNNGG	3 cut(s)	528, 597, 717
BssMI	GATC	2 cut(s)	81, 385
BssT1I	CCWWGG	3 cut(s)	528, 597, 717
Bst4CI	ACNGT	1 cut(s)	73
Bst6I	CTCTTC	1 cut(s)	681
BstAPI	GCANNNNNTGC	1 cut(s)	816
BstBI	TTCGAA	1 cut(s)	199
BstDEI	CTNAG	1 cut(s)	192
BstDSI	CCRYGG	2 cut(s)	597, 717
BstF5I	GGATG	3 cut(s)	289, 322, 469
BstFNI	CGCG	1 cut(s)	64
BstHHI	GCGC	2 cut(s)	64, 559
BstKTI	GATC	2 cut(s)	84, 388
BstMAI	GTCTC	4 cut(s)	439, 453, 476, 499
BstMBI	GATC	2 cut(s)	81, 385
BstMWI	GCNNNNNNNGC	5 cut(s)	148, 533, 563, 593, 816
BstUI	CGCG	1 cut(s)	64
BstV1I	GCAGC	3 cut(s)	578, 643, 822
BstX2I	RGATCY	1 cut(s)	385
BstXI	CCANNNNNNTGG	1 cut(s)	280
BstYI	RGATCY	1 cut(s)	385
BsuI	GTATCC	1 cut(s)	715
BsuRI	GGCC	1 cut(s)	716
BtgI	CCRYGG	2 cut(s)	597, 717
BtsCI	GGATG	3 cut(s)	289, 322, 469
CciI	TCATGA	1 cut(s)	312
CfoI	GCGC	2 cut(s)	64, 559
Cfr10I	RCCGGY	1 cut(s)	409
Cfr13I	GGNCC	1 cut(s)	155
Csp6I	GTAC	1 cut(s)	15
CviAII	CATG	7 cut(s)	57, 128, 313, 499, 598, 718, 733
CviQI	GTAC	1 cut(s)	15
DdeI	CTNAG	1 cut(s)	192
DpnI	GATC	2 cut(s)	83, 387
DpnII	GATC	2 cut(s)	81, 385
DriI	GACNNNNNGTC	1 cut(s)	75
EaeI	YGGCCR	1 cut(s)	714
Eam1104I	CTCTTC	1 cut(s)	681
Eam1105I	GACNNNNNGTC	1 cut(s)	75
EarI	CTCTTC	1 cut(s)	681
Eco130I	CCWWGG	3 cut(s)	528, 597, 717
Eco31I	GGTCTC	1 cut(s)	499
Eco32I	GATATC	2 cut(s)	307, 778
Eco47I	GGWCC	1 cut(s)	155
EcoRI	GAATTC	1 cut(s)	213
EcoRV	GATATC	2 cut(s)	307, 778
EcoT14I	CCWWGG	3 cut(s)	528, 597, 717
ErhI	CCWWGG	3 cut(s)	528, 597, 717
FaeI	CATG	7 cut(s)	60, 131, 316, 502, 601, 721, 736
FaqI	GGGAC	1 cut(s)	528
FatI	CATG	7 cut(s)	56, 127, 312, 498, 597, 717, 732
Fnu4HI	GCNGC	3 cut(s)	567, 657, 811
FokI	GGATG	3 cut(s)	296, 309, 476
Fsp4HI	GCNGC	3 cut(s)	567, 657, 811
FspBI	CTAG	2 cut(s)	429, 629
GlaI	GCGC	2 cut(s)	63, 558
GluI	GCNGC	3 cut(s)	567, 657, 811
HaeIII	GGCC	1 cut(s)	716
HapII	CCGG	1 cut(s)	410
HhaI	GCGC	2 cut(s)	64, 559
Hin1II	CATG	7 cut(s)	60, 131, 316, 502, 601, 721, 736
Hin6I	GCGC	2 cut(s)	62, 557
HinP1I	GCGC	2 cut(s)	62, 557
HindIII	AAGCTT	1 cut(s)	615
HinfI	GANTC	3 cut(s)	53, 446, 605
HpaII	CCGG	1 cut(s)	410
HphI	GGTGA	2 cut(s)	362, 785
Hpy166II	GTNNAC	1 cut(s)	158
Hpy188I	TCNGA	3 cut(s)	81, 439, 799
Hpy188III	TCNNGA	2 cut(s)	302, 313
Hpy8I	GTNNAC	1 cut(s)	158
HpyAV	CCTTC	2 cut(s)	547, 664
HpyCH4III	ACNGT	1 cut(s)	73
HpyCH4V	TGCA	4 cut(s)	142, 236, 566, 704
HpyF10VI	GCNNNNNNNGC	5 cut(s)	148, 533, 563, 593, 816
HpyF3I	CTNAG	1 cut(s)	192
Hsp92II	CATG	7 cut(s)	60, 131, 316, 502, 601, 721, 736
HspAI	GCGC	2 cut(s)	62, 557
Kzo9I	GATC	2 cut(s)	81, 385
LmnI	GCTCC	2 cut(s)	5, 34
LpnPI	CCDG	1 cut(s)	423
Lsp1109I	GCAGC	3 cut(s)	578, 643, 822
LweI	GCATC	3 cut(s)	422, 553, 691
MaeI	CTAG	2 cut(s)	429, 629
MalI	GATC	2 cut(s)	83, 387
MbiI	CCGCTC	1 cut(s)	267
MboI	GATC	2 cut(s)	81, 385
MboII	GAAGA	6 cut(s)	301, 553, 646, 659, 698, 710
MfeI	CAATTG	2 cut(s)	44, 453
MflI	RGATCY	1 cut(s)	385
MlsI	TGGCCA	1 cut(s)	716
MluNI	TGGCCA	1 cut(s)	716
MlyI	GAGTC	1 cut(s)	455
MnlI	CCTC	7 cut(s)	25, 115, 186, 280, 505, 682, 837
Mox20I	TGGCCA	1 cut(s)	716
MroXI	GAANNNNTTC	1 cut(s)	123
MscI	TGGCCA	1 cut(s)	716
MseI	TTAA	2 cut(s)	363, 838
Msp20I	TGGCCA	1 cut(s)	716
MspA1I	CMGCKG	1 cut(s)	813
MspI	CCGG	1 cut(s)	410
MunI	CAATTG	2 cut(s)	44, 453
MvnI	CGCG	1 cut(s)	64
MwoI	GCNNNNNNNGC	5 cut(s)	148, 533, 563, 593, 816
NcoI	CCATGG	2 cut(s)	597, 717
NdeII	GATC	2 cut(s)	81, 385
NlaIII	CATG	7 cut(s)	60, 131, 316, 502, 601, 721, 736
NlaIV	GGNNCC	2 cut(s)	271, 387
NmeAIII	GCCGAG	1 cut(s)	528
NspV	TTCGAA	1 cut(s)	199
PagI	TCATGA	1 cut(s)	312
PcsI	WCGNNNNNNNCGW	1 cut(s)	77
PdmI	GAANNNNTTC	1 cut(s)	123
PfeI	GAWTC	2 cut(s)	53, 605
PkrI	GCNGC	3 cut(s)	568, 658, 812
PleI	GAGTC	1 cut(s)	454
PpsI	GAGTC	1 cut(s)	454
PspN4I	GGNNCC	2 cut(s)	271, 387
PspPI	GGNCC	1 cut(s)	155
PsuI	RGATCY	1 cut(s)	385
RsaI	GTAC	1 cut(s)	16
RsaNI	GTAC	1 cut(s)	15
SaqAI	TTAA	2 cut(s)	363, 838
SatI	GCNGC	3 cut(s)	567, 657, 811
Sau3AI	GATC	2 cut(s)	81, 385
Sau96I	GGNCC	1 cut(s)	155
SchI	GAGTC	1 cut(s)	455
SetI	ASST	8 cut(s)	10, 157, 184, 497, 619, 630, 675, 829
SfaNI	GCATC	3 cut(s)	422, 553, 691
SfuI	TTCGAA	1 cut(s)	199
SinI	GGWCC	1 cut(s)	155
SmlI	CTYRAG	2 cut(s)	177, 612
SmoI	CTYRAG	2 cut(s)	177, 612
SpeI	ACTAGT	1 cut(s)	428
SsiI	CCGC	2 cut(s)	267, 813
SspMI	CTAG	2 cut(s)	429, 629
StyI	CCWWGG	3 cut(s)	528, 597, 717
TaaI	ACNGT	1 cut(s)	73
TaqI	TCGA	4 cut(s)	30, 199, 422, 834
TfiI	GAWTC	2 cut(s)	53, 605
Tru1I	TTAA	2 cut(s)	363, 838
Tru9I	TTAA	2 cut(s)	363, 838
TseI	GCWGC	3 cut(s)	566, 656, 810
TspDTI	ATGAA	5 cut(s)	45, 116, 301, 329, 483
VpaK11BI	GGWCC	1 cut(s)	155
XapI	RAATTY	4 cut(s)	39, 213, 341, 680
XmnI	GAANNNNTTC	1 cut(s)	123
XspI	CTAG	2 cut(s)	429, 629

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.