Rroxscaffold_3G00232550

No apical meristem-associated C-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
18200458 .. 18202171
1714 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00232550.1

Sequence Viewer

Length: 387 bp
ATGGATCCACTCCCGCTTTCATGGCTCATCCTTGTCCACCGGGCGAGGTTGGAGACCCTTCGCTATGGTCGACTTTATGCCCGTATGTTTAGAATTCGGCCCGAGCGTGTCCGATGGTCCGGTGCCGGGCAAGTGCAATGTTTTCATCTTCCATCGAGCACGAAGTGGGCAATTGATGAGGAAGTGCAATTGTGCAAGTCTTGGGCAACTATTACTTCATGTGGTTTTGTAGGAAAGGATCAAGATGCCAAACATCTATGGCGTAATATTCATCCTCACTACCAACAAAATTGGGAAGGTGATCGGAAGATGTTCGATCCCATCAAGCACTCTAAAGTAGGTGGAAAAATTTTAAAAACAAATTGCGGAGTTGTCATGATGCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

128

Amino Acids

15.05

Weight (kDa)

9.91

Isoelectric Point (pI)

39.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 122
AccI GTMKAC 1 cut(s) 70
AciI CCGC 3 cut(s) 14, 366, 382
AclWI GGATC 3 cut(s) 12, 246, 311
AcsI RAATTY 2 cut(s) 93, 348
AdeI CACNNNGTG 1 cut(s) 165
AfiI CCNNNNNNNGG 1 cut(s) 126
Alw21I GWGCWC 1 cut(s) 161
Alw26I GTCTC 1 cut(s) 47
AlwI GGATC 3 cut(s) 12, 246, 311
Ama87I CYCGRG 1 cut(s) 101
AoxI GGCC 1 cut(s) 98
ApoI RAATTY 2 cut(s) 93, 348
Asp700I GAANNNNTTC 1 cut(s) 311
AspS9I GGNCC 2 cut(s) 99, 117
AsuC2I CCSGG 2 cut(s) 41, 127
AsuHPI GGTGA 1 cut(s) 311
AvaI CYCGRG 1 cut(s) 101
AvaII GGWCC 1 cut(s) 117
BamHI GGATCC 1 cut(s) 4
BanI GGYRCC 1 cut(s) 122
Bbv12I GWGCWC 1 cut(s) 161
BccI CCATC 3 cut(s) 108, 160, 329
BcnI CCSGG 2 cut(s) 41, 127
BcoDI GTCTC 1 cut(s) 47
Bme1390I CCNGG 2 cut(s) 41, 127
Bme18I GGWCC 1 cut(s) 117
BmeT110I CYCGRG 1 cut(s) 101
BmgT120I GGNCC 2 cut(s) 99, 117
BmiI GGNNCC 2 cut(s) 6, 124
BmrFI CCNGG 2 cut(s) 41, 127
BmsI GCATC 2 cut(s) 235, 369
BpuMI CCSGG 2 cut(s) 41, 127
BsaI GGTCTC 1 cut(s) 47
BsaWI WCCGGW 1 cut(s) 119
Bsc4I CCNNNNNNNGG 1 cut(s) 126
Bse3DI GCAATG 1 cut(s) 143
BseGI GGATG 2 cut(s) 27, 271
BseLI CCNNNNNNNGG 1 cut(s) 126
BseMI GCAATG 1 cut(s) 143
BshFI GGCC 1 cut(s) 100
BshNI GGYRCC 1 cut(s) 122
BsiHKAI GWGCWC 1 cut(s) 161
BsiHKCI CYCGRG 1 cut(s) 101
BsiSI CCGG 3 cut(s) 40, 120, 126
BslI CCNNNNNNNGG 1 cut(s) 126
BsmAI GTCTC 1 cut(s) 47
BsnI GGCC 1 cut(s) 100
Bso31I GGTCTC 1 cut(s) 47
BsoBI CYCGRG 1 cut(s) 101
Bsp1286I GDGCHC 1 cut(s) 161
Bsp143I GATC 4 cut(s) 4, 238, 301, 316
BspACI CCGC 3 cut(s) 14, 366, 382
BspANI GGCC 1 cut(s) 100
BspHI TCATGA 1 cut(s) 375
BspLI GGNNCC 2 cut(s) 6, 124
BspPI GGATC 3 cut(s) 12, 246, 311
BspT107I GGYRCC 1 cut(s) 122
BspTNI GGTCTC 1 cut(s) 47
BsrDI GCAATG 1 cut(s) 143
BssMI GATC 4 cut(s) 4, 238, 301, 316
BstF5I GGATG 2 cut(s) 27, 271
BstKTI GATC 4 cut(s) 7, 241, 304, 319
BstMAI GTCTC 1 cut(s) 47
BstMBI GATC 4 cut(s) 4, 238, 301, 316
BstMWI GCNNNNNNNGC 1 cut(s) 22
BstSCI CCNGG 2 cut(s) 39, 125
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BsuRI GGCC 1 cut(s) 100
BtsCI GGATG 2 cut(s) 27, 271
CciI TCATGA 1 cut(s) 375
Cfr13I GGNCC 2 cut(s) 99, 117
CviAII CATG 3 cut(s) 21, 219, 376
CviJI RGCY 2 cut(s) 25, 100
CviKI_1 RGCY 2 cut(s) 25, 100
DpnI GATC 4 cut(s) 6, 240, 303, 318
DpnII GATC 4 cut(s) 4, 238, 301, 316
DraI TTTAAA 1 cut(s) 354
DraIII CACNNNGTG 1 cut(s) 165
Eco31I GGTCTC 1 cut(s) 47
Eco47I GGWCC 1 cut(s) 117
Eco88I CYCGRG 1 cut(s) 101
EcoRI GAATTC 1 cut(s) 93
FaeI CATG 3 cut(s) 24, 222, 379
FaiI YATR 7 cut(s) 22, 66, 78, 86, 220, 259, 377
FatI CATG 3 cut(s) 20, 218, 375
FauI CCCGC 1 cut(s) 21
FblI GTMKAC 1 cut(s) 70
FokI GGATG 2 cut(s) 14, 258
HaeIII GGCC 1 cut(s) 100
HapII CCGG 3 cut(s) 40, 120, 126
Hin1II CATG 3 cut(s) 24, 222, 379
HincII GTYRAC 1 cut(s) 71
HindII GTYRAC 1 cut(s) 71
HpaII CCGG 3 cut(s) 40, 120, 126
HphI GGTGA 1 cut(s) 311
Hpy166II GTNNAC 2 cut(s) 37, 71
Hpy188I TCNGA 2 cut(s) 113, 306
Hpy188III TCNNGA 2 cut(s) 242, 376
Hpy8I GTNNAC 2 cut(s) 37, 71
HpyAV CCTTC 2 cut(s) 68, 290
HpyCH4V TGCA 3 cut(s) 136, 187, 195
HpyF10VI GCNNNNNNNGC 1 cut(s) 22
Hsp92II CATG 3 cut(s) 24, 222, 379
Kzo9I GATC 4 cut(s) 4, 238, 301, 316
LpnPI CCDG 3 cut(s) 53, 133, 139
LweI GCATC 2 cut(s) 235, 369
MalI GATC 4 cut(s) 6, 240, 303, 318
MboI GATC 4 cut(s) 4, 238, 301, 316
MboII GAAGA 2 cut(s) 140, 319
MfeI CAATTG 2 cut(s) 171, 188
MflI RGATCY 1 cut(s) 4
MhlI GDGCHC 1 cut(s) 161
MluCI AATT 6 cut(s) 93, 171, 188, 289, 348, 361
MmeI TCCRAC 1 cut(s) 30
MnlI CCTC 3 cut(s) 39, 172, 285
MroXI GAANNNNTTC 1 cut(s) 311
MseI TTAA 1 cut(s) 353
MspI CCGG 3 cut(s) 40, 120, 126
MspR9I CCNGG 2 cut(s) 41, 127
MunI CAATTG 2 cut(s) 171, 188
MwoI GCNNNNNNNGC 1 cut(s) 22
NciI CCSGG 2 cut(s) 41, 127
NdeII GATC 4 cut(s) 4, 238, 301, 316
NlaIII CATG 3 cut(s) 24, 222, 379
NlaIV GGNNCC 2 cut(s) 6, 124
PagI TCATGA 1 cut(s) 375
PcsI WCGNNNNNNNCGW 2 cut(s) 67, 103
PdmI GAANNNNTTC 1 cut(s) 311
PspN4I GGNNCC 2 cut(s) 6, 124
PspPI GGNCC 2 cut(s) 99, 117
PsuI RGATCY 1 cut(s) 4
SalI GTCGAC 1 cut(s) 69
SaqAI TTAA 1 cut(s) 353
Sau3AI GATC 4 cut(s) 4, 238, 301, 316
Sau96I GGNCC 2 cut(s) 99, 117
ScrFI CCNGG 2 cut(s) 41, 127
SduI GDGCHC 1 cut(s) 161
SetI ASST 3 cut(s) 50, 301, 343
SfaNI GCATC 2 cut(s) 235, 369
SinI GGWCC 1 cut(s) 117
Sse9I AATT 6 cut(s) 93, 171, 188, 289, 348, 361
SsiI CCGC 3 cut(s) 14, 366, 382
SspI AATATT 1 cut(s) 268
StyD4I CCNGG 2 cut(s) 39, 125
TaqI TCGA 3 cut(s) 70, 155, 315
TasI AATT 6 cut(s) 93, 171, 188, 289, 348, 361
Tru1I TTAA 1 cut(s) 353
Tru9I TTAA 1 cut(s) 353
TspDTI ATGAA 4 cut(s) 9, 134, 207, 260
VpaK11BI GGWCC 1 cut(s) 117
XapI RAATTY 2 cut(s) 93, 348
XmiI GTMKAC 1 cut(s) 70
XmnI GAANNNNTTC 1 cut(s) 311
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.