Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr8

Orthogroup ID

OG0000206

Physical Location & Seq

Genomic Coordinates Forward (+)

19063986 .. 19065223

Gene Structure 1238 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom08g18990.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1017 bp

ATGACTTCGTGGAAGCTCAGTGAAGATGTTACGTTGTGTGAATGTTGGGTTCGCACTACTCATGACCCGATTACGGGTAATGAGATGGATAAGCGAGAAATGTGGAGTAAAATTACGAAATTGTTTTGCGATGTACATGGAAAAGATGTACATGGAAAAGATGCCAGATCTAGTCAAGGTCTTCAAGGTCGTTGGAAAAAACTCAACGCATCCTTTACTTGTTGGAAAAACGCCCTCTCTCATGCTTCTGGTAATCTGCGTAGTGGGACAAGTTTAGCGGATGAGACACTACAAGCACAAGCATTCTACAATGCAAAGAACCATAACAAATCATTCAACAAATGGGAATGTTGGCAAATTGTCAAAGATTGCCCTAGATACAAAATTGTGGCAACCGGTCCAGAAGTTATCATGCACGGTATGGGTCTACACAGTTCGCCAGAAGCAGACACAGCCGAACAAGAAGCCAACACATTTGAAGACACGGAAGGGACGCCTGAACAAGTGCCAGAGACCCAACCGACTCGTCAGTCCCTCAGGCCTCAAGGTAAAAAGGCATCAAAGAAAAAAGGTAGTTCTTCCAAAAATGACTACACTAAATATATGGAGGAACTTACTCGTCAAGGTGAACTGAACATGGCATGGGAAAAGGCTAGAGATGAGGAAAAAGCTGCTGCTATGGCAGCAATTATTGCAGCTACTGAGGCTCGTGATGCGGCGGCTGAGAGACAAAAAGAAATAGTTAATCGAGAGAACGAGATGATTAGAGAAGCACTTCATCGAGAGAATGAGATGCTTAGAGAAGAAAGGATGGCTCAAACAGATCGTGACACTATGAACAAGTCTCTAGTAGGACTGTCTCCGAATTCAAAATATTTTTGGACATCAGAAAAAAGAGATGTCGTGCGAAGGAGGCGTGCAAGAGATGCCGAAACAAGTCAAGGGGGTTCCAGCTACAGAAATCCTAGCAACCAAGATCCTAGCACCACATATCCTAACTCCACAGACTTTGTATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000413 GO:0003674 GO:0003755 GO:0003824 GO:0005488 GO:0005515 GO:0005516 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006807 GO:0007275 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016853 GO:0016859 GO:0018193 GO:0018208 GO:0019538 GO:0032501 GO:0032502 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0048366 GO:0048367 GO:0048731 GO:0048827 GO:0048856 GO:0071704 GO:0071944 GO:0099402 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FKBP_C TPR_2 TPR_8

Protein Analysis

339

Amino Acids

38.5

Weight (kDa)

7.63

Isoelectric Point (pI)

52.54

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000206)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica	MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis	pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis	RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata	RLG00000030820
rosa_multiflora	Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii	Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa	Rorug03G0276400 Rorug03G0276400
rosa_samantha	Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana	Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	529
AccI	GTMKAC	1 cut(s)	427
AciI	CCGC	3 cut(s)	278, 716, 719
AclWI	GGATC	1 cut(s)	971
AcsI	RAATTY	1 cut(s)	865
AcyI	GRCGYC	1 cut(s)	494
AfaI	GTAC	2 cut(s)	135, 150
AfiI	CCNNNNNNNGG	2 cut(s)	73, 74
AgeI	ACCGGT	1 cut(s)	395
AgsI	TTSAA	4 cut(s)	185, 337, 479, 870
AluBI	AGCT	4 cut(s)	16, 671, 698, 954
AluI	AGCT	4 cut(s)	16, 671, 698, 954
Alw26I	GTCTC	5 cut(s)	278, 506, 721, 849, 864
AlwI	GGATC	1 cut(s)	971
AlwNI	CAGNNNCTG	1 cut(s)	701
AoxI	GGCC	1 cut(s)	539
ApeKI	GCWGC	4 cut(s)	671, 674, 683, 695
ApoI	RAATTY	1 cut(s)	865
AsiGI	ACCGGT	1 cut(s)	395
Asp700I	GAANNNNTTC	1 cut(s)	774
AspS9I	GGNCC	1 cut(s)	398
AsuHPI	GGTGA	1 cut(s)	638
AvaII	GGWCC	1 cut(s)	398
AxyI	CCTNAGG	1 cut(s)	536
BauI	CACGAG	1 cut(s)	708
BbsI	GAAGAC	2 cut(s)	173, 486
BbvI	GCAGC	4 cut(s)	658, 661, 695, 707
BccI	CCATC	2 cut(s)	79, 805
BcoDI	GTCTC	5 cut(s)	278, 506, 721, 849, 864
BfaI	CTAG	6 cut(s)	171, 375, 654, 848, 966, 981
BfmI	CTRYAG	1 cut(s)	955
BglII	AGATCT	1 cut(s)	167
BisI	GCNGC	6 cut(s)	672, 675, 684, 696, 717, 720
BlsI	GCNGC	6 cut(s)	673, 676, 685, 697, 718, 721
Bme18I	GGWCC	1 cut(s)	398
BmgT120I	GGNCC	1 cut(s)	398
BmiI	GGNNCC	1 cut(s)	949
BmsI	GCATC	6 cut(s)	151, 218, 566, 703, 783, 916
BpiI	GAAGAC	2 cut(s)	173, 486
BpuEI	CTTGAG	1 cut(s)	528
BsaHI	GRCGYC	1 cut(s)	494
BsaI	GGTCTC	1 cut(s)	506
BsaWI	WCCGGW	1 cut(s)	395
Bsc4I	CCNNNNNNNGG	2 cut(s)	73, 74
Bse118I	RCCGGY	1 cut(s)	395
Bse21I	CCTNAGG	1 cut(s)	536
BseGI	GGATG	3 cut(s)	209, 286, 816
BseLI	CCNNNNNNNGG	2 cut(s)	73, 74
BseMII	CTCAG	4 cut(s)	31, 550, 693, 714
BseXI	GCAGC	4 cut(s)	658, 661, 695, 707
BshFI	GGCC	1 cut(s)	541
BshTI	ACCGGT	1 cut(s)	395
BsiSI	CCGG	1 cut(s)	396
BslFI	GGGAC	3 cut(s)	280, 505, 517
BslI	CCNNNNNNNGG	2 cut(s)	73, 74
BsmAI	GTCTC	5 cut(s)	278, 506, 721, 849, 864
BsmFI	GGGAC	3 cut(s)	280, 505, 517
BsmI	GAATGC	1 cut(s)	302
BsnI	GGCC	1 cut(s)	541
Bso31I	GGTCTC	1 cut(s)	506
Bsp1407I	TGTACA	2 cut(s)	133, 148
Bsp143I	GATC	3 cut(s)	167, 823, 976
BspACI	CCGC	3 cut(s)	278, 716, 719
BspANI	GGCC	1 cut(s)	541
BspCNI	CTCAG	4 cut(s)	30, 549, 694, 715
BspHI	TCATGA	1 cut(s)	61
BspLI	GGNNCC	1 cut(s)	949
BspPI	GGATC	1 cut(s)	971
BspTNI	GGTCTC	1 cut(s)	506
BsrFI	RCCGGY	1 cut(s)	395
BsrGI	TGTACA	2 cut(s)	133, 148
BssAI	RCCGGY	1 cut(s)	395
BssMI	GATC	3 cut(s)	167, 823, 976
BssNI	GRCGYC	1 cut(s)	494
BssSI	CACGAG	1 cut(s)	708
Bst2BI	CACGAG	1 cut(s)	708
Bst4CI	ACNGT	3 cut(s)	419, 434, 858
BstACI	GRCGYC	1 cut(s)	494
BstAPI	GCANNNNNTGC	2 cut(s)	692, 926
BstAUI	TGTACA	2 cut(s)	133, 148
BstC8I	GCNNGC	1 cut(s)	918
BstDEI	CTNAG	5 cut(s)	17, 536, 702, 723, 797
BstF5I	GGATG	3 cut(s)	209, 286, 816
BstKTI	GATC	3 cut(s)	170, 826, 979
BstMAI	GTCTC	5 cut(s)	278, 506, 721, 849, 864
BstMBI	GATC	3 cut(s)	167, 823, 976
BstMWI	GCNNNNNNNGC	8 cut(s)	452, 680, 683, 692, 704, 713, 913, 926
BstSFI	CTRYAG	1 cut(s)	955
BstV1I	GCAGC	4 cut(s)	658, 661, 695, 707
BstV2I	GAAGAC	2 cut(s)	173, 486
BstX2I	RGATCY	2 cut(s)	167, 976
BstYI	RGATCY	2 cut(s)	167, 976
Bsu36I	CCTNAGG	1 cut(s)	536
BsuRI	GGCC	1 cut(s)	541
BtgZI	GCGATG	1 cut(s)	144
BtsCI	GGATG	3 cut(s)	209, 286, 816
BtsIMutI	CAGTG	1 cut(s)	25
Cac8I	GCNNGC	1 cut(s)	918
CaiI	CAGNNNCTG	1 cut(s)	701
CciI	TCATGA	1 cut(s)	61
Cfr10I	RCCGGY	1 cut(s)	395
Cfr13I	GGNCC	1 cut(s)	398
CseI	GACGC	1 cut(s)	502
Csp6I	GTAC	2 cut(s)	134, 149
CspAI	ACCGGT	1 cut(s)	395
CspCI	CAANNNNNGTGG	1 cut(s)	991
CviAII	CATG	7 cut(s)	62, 137, 152, 242, 412, 637, 642
CviQI	GTAC	2 cut(s)	134, 149
DdeI	CTNAG	5 cut(s)	17, 536, 702, 723, 797
DpnI	GATC	3 cut(s)	169, 825, 978
DpnII	GATC	3 cut(s)	167, 823, 976
DrdI	GACNNNNNNGTC	1 cut(s)	529
DseDI	GACNNNNNNGTC	1 cut(s)	529
Eco147I	AGGCCT	1 cut(s)	541
Eco31I	GGTCTC	1 cut(s)	506
Eco47I	GGWCC	1 cut(s)	398
Eco81I	CCTNAGG	1 cut(s)	536
EcoRI	GAATTC	1 cut(s)	865
FaeI	CATG	7 cut(s)	65, 140, 155, 245, 415, 640, 645
FaqI	GGGAC	3 cut(s)	280, 505, 517
FatI	CATG	7 cut(s)	61, 136, 151, 241, 411, 636, 641
FblI	GTMKAC	1 cut(s)	427
Fnu4HI	GCNGC	6 cut(s)	672, 675, 684, 696, 717, 720
FokI	GGATG	3 cut(s)	196, 293, 823
Fsp4HI	GCNGC	6 cut(s)	672, 675, 684, 696, 717, 720
FspBI	CTAG	6 cut(s)	171, 375, 654, 848, 966, 981
GluI	GCNGC	6 cut(s)	672, 675, 684, 696, 717, 720
HaeIII	GGCC	1 cut(s)	541
HapII	CCGG	1 cut(s)	396
HgaI	GACGC	1 cut(s)	502
Hin1I	GRCGYC	1 cut(s)	494
Hin1II	CATG	7 cut(s)	65, 140, 155, 245, 415, 640, 645
HinfI	GANTC	1 cut(s)	523
HpaII	CCGG	1 cut(s)	396
HphI	GGTGA	1 cut(s)	638
Hpy166II	GTNNAC	2 cut(s)	428, 629
Hpy188I	TCNGA	2 cut(s)	864, 889
Hpy188III	TCNNGA	6 cut(s)	62, 401, 710, 749, 782, 827
Hpy8I	GTNNAC	2 cut(s)	428, 629
HpyAV	CCTTC	2 cut(s)	482, 903
HpyCH4III	ACNGT	3 cut(s)	419, 434, 858
HpyCH4IV	ACGT	1 cut(s)	32
HpyCH4V	TGCA	4 cut(s)	314, 415, 695, 920
HpyF10VI	GCNNNNNNNGC	8 cut(s)	452, 680, 683, 692, 704, 713, 913, 926
HpyF3I	CTNAG	5 cut(s)	17, 536, 702, 723, 797
HpySE526I	ACGT	1 cut(s)	32
Hsp92I	GRCGYC	1 cut(s)	494
Hsp92II	CATG	7 cut(s)	65, 140, 155, 245, 415, 640, 645
Kzo9I	GATC	3 cut(s)	167, 823, 976
LpnPI	CCDG	9 cut(s)	178, 234, 409, 414, 453, 510, 522, 523, 964
Lsp1109I	GCAGC	4 cut(s)	658, 661, 695, 707
LweI	GCATC	6 cut(s)	151, 218, 566, 703, 783, 916
MaeI	CTAG	6 cut(s)	171, 375, 654, 848, 966, 981
MaeII	ACGT	1 cut(s)	32
MaeIII	GTNAC	2 cut(s)	28, 827
MalI	GATC	3 cut(s)	169, 825, 978
MboI	GATC	3 cut(s)	167, 823, 976
MboII	GAAGA	5 cut(s)	35, 173, 491, 570, 815
MflI	RGATCY	2 cut(s)	167, 976
MluCI	AATT	6 cut(s)	111, 119, 357, 384, 687, 865
MlyI	GAGTC	1 cut(s)	517
MmeI	TCCRAC	2 cut(s)	173, 203
MnlI	CCTC	7 cut(s)	245, 545, 552, 601, 655, 697, 906
MroXI	GAANNNNTTC	1 cut(s)	774
MseI	TTAA	1 cut(s)	744
MspI	CCGG	1 cut(s)	396
Mva1269I	GAATGC	1 cut(s)	302
MwoI	GCNNNNNNNGC	8 cut(s)	452, 680, 683, 692, 704, 713, 913, 926
NdeII	GATC	3 cut(s)	167, 823, 976
NlaIII	CATG	7 cut(s)	65, 140, 155, 245, 415, 640, 645
NlaIV	GGNNCC	1 cut(s)	949
NmuCI	GTSAC	1 cut(s)	827
PagI	TCATGA	1 cut(s)	61
PceI	AGGCCT	1 cut(s)	541
PctI	GAATGC	1 cut(s)	302
PdmI	GAANNNNTTC	1 cut(s)	774
PinAI	ACCGGT	1 cut(s)	395
PkrI	GCNGC	6 cut(s)	673, 676, 685, 697, 718, 721
PleI	GAGTC	1 cut(s)	517
PpsI	GAGTC	1 cut(s)	517
PspN4I	GGNNCC	1 cut(s)	949
PspPI	GGNCC	1 cut(s)	398
PstNI	CAGNNNCTG	1 cut(s)	701
PsuI	RGATCY	2 cut(s)	167, 976
RsaI	GTAC	2 cut(s)	135, 150
RsaNI	GTAC	2 cut(s)	134, 149
SaqAI	TTAA	1 cut(s)	744
SatI	GCNGC	6 cut(s)	672, 675, 684, 696, 717, 720
Sau3AI	GATC	3 cut(s)	167, 823, 976
Sau96I	GGNCC	1 cut(s)	398
SchI	GAGTC	1 cut(s)	517
SfaNI	GCATC	6 cut(s)	151, 218, 566, 703, 783, 916
SfcI	CTRYAG	1 cut(s)	955
SinI	GGWCC	1 cut(s)	398
SmlI	CTYRAG	1 cut(s)	543
SmoI	CTYRAG	1 cut(s)	543
Sse9I	AATT	6 cut(s)	111, 119, 357, 384, 687, 865
SseBI	AGGCCT	1 cut(s)	541
SsiI	CCGC	3 cut(s)	278, 716, 719
SspI	AATATT	1 cut(s)	875
SspMI	CTAG	6 cut(s)	171, 375, 654, 848, 966, 981
StuI	AGGCCT	1 cut(s)	541
TaaI	ACNGT	3 cut(s)	419, 434, 858
TaiI	ACGT	1 cut(s)	35
TaqI	TCGA	2 cut(s)	748, 781
TasI	AATT	6 cut(s)	111, 119, 357, 384, 687, 865
TatI	WGTACW	2 cut(s)	133, 148
TauI	GCSGC	2 cut(s)	719, 722
Tru1I	TTAA	1 cut(s)	744
Tru9I	TTAA	1 cut(s)	744
TscAI	CASTG	1 cut(s)	25
TseFI	GTSAC	1 cut(s)	827
TseI	GCWGC	4 cut(s)	671, 674, 683, 695
Tsp45I	GTSAC	1 cut(s)	827
TspDTI	ATGAA	2 cut(s)	767, 851
TspGWI	ACGGA	1 cut(s)	500
TspRI	CASTG	1 cut(s)	25
VpaK11BI	GGWCC	1 cut(s)	398
XapI	RAATTY	1 cut(s)	865
XmiI	GTMKAC	1 cut(s)	427
XmnI	GAANNNNTTC	1 cut(s)	774
XspI	CTAG	6 cut(s)	171, 375, 654, 848, 966, 981

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.