pycom13g14570

Peptidyl-prolyl cis-trans isomerase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
10554338 .. 10554691
354 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 354 bp
ATGACTTCGTGGAAGCTCATTGAAGATGTTACGTTGTGTGAATGTTGGGTTCGCACTACTCATGACCCGATTACGGGTAATGAGATGGATAAGCGAGAAATGTGGAGTAAAATTACGAAATCGTTTTGCGATGTACATGGAAAAGATGCCAGATCTAGTCAAGGTCTTCAAGGTCGTTGGAAAAAACTCAACGCATCCTTTACTTGTTGGAAAAACGTCATCTCTCATGCTTCTGATAATCTGCGTAGTGGGACAAGTTTAGCCGATGAGGTAACAATATTTTTATTTATTTATATGCATTCCACCCACATCAATATTTTAATTTATTTAATTTCTTATGTAATTTCTATGTAA

Protein Analysis

118

Amino Acids

13.53

Weight (kDa)

7.72

Isoelectric Point (pI)

55.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 135
AfiI CCNNNNNNNGG 2 cut(s) 73, 74
AgsI TTSAA 2 cut(s) 23, 170
AluBI AGCT 1 cut(s) 16
AluI AGCT 1 cut(s) 16
BbsI GAAGAC 1 cut(s) 158
BccI CCATC 1 cut(s) 79
BfaI CTAG 1 cut(s) 156
BglII AGATCT 1 cut(s) 152
BmsI GCATC 2 cut(s) 136, 203
BpiI GAAGAC 1 cut(s) 158
Bsc4I CCNNNNNNNGG 2 cut(s) 73, 74
BseGI GGATG 1 cut(s) 194
BseLI CCNNNNNNNGG 2 cut(s) 73, 74
BslFI GGGAC 1 cut(s) 265
BslI CCNNNNNNNGG 2 cut(s) 73, 74
BsmFI GGGAC 1 cut(s) 265
BsmI GAATGC 1 cut(s) 298
Bsp1407I TGTACA 1 cut(s) 133
Bsp143I GATC 1 cut(s) 152
BspHI TCATGA 1 cut(s) 61
BsrGI TGTACA 1 cut(s) 133
BssMI GATC 1 cut(s) 152
BstAUI TGTACA 1 cut(s) 133
BstF5I GGATG 1 cut(s) 194
BstKTI GATC 1 cut(s) 155
BstMBI GATC 1 cut(s) 152
BstV2I GAAGAC 1 cut(s) 158
BstX2I RGATCY 1 cut(s) 152
BstYI RGATCY 1 cut(s) 152
BtgZI GCGATG 1 cut(s) 144
BtsCI GGATG 1 cut(s) 194
CciI TCATGA 1 cut(s) 61
Csp6I GTAC 1 cut(s) 134
CviAII CATG 3 cut(s) 62, 137, 227
CviJI RGCY 2 cut(s) 16, 263
CviKI_1 RGCY 2 cut(s) 16, 263
CviQI GTAC 1 cut(s) 134
DpnI GATC 1 cut(s) 154
DpnII GATC 1 cut(s) 152
EcoT22I ATGCAT 1 cut(s) 300
FaeI CATG 3 cut(s) 65, 140, 230
FaiI YATR 7 cut(s) 63, 138, 228, 294, 296, 339, 350
FaqI GGGAC 1 cut(s) 265
FatI CATG 3 cut(s) 61, 136, 226
FokI GGATG 1 cut(s) 181
FspBI CTAG 1 cut(s) 156
Hin1II CATG 3 cut(s) 65, 140, 230
Hpy188I TCNGA 1 cut(s) 235
Hpy188III TCNNGA 1 cut(s) 62
HpyCH4IV ACGT 2 cut(s) 32, 216
HpyCH4V TGCA 1 cut(s) 298
HpySE526I ACGT 2 cut(s) 32, 216
Hsp92II CATG 3 cut(s) 65, 140, 230
Kzo9I GATC 1 cut(s) 152
LpnPI CCDG 1 cut(s) 163
LweI GCATC 2 cut(s) 136, 203
MaeI CTAG 1 cut(s) 156
MaeII ACGT 2 cut(s) 32, 216
MaeIII GTNAC 2 cut(s) 28, 271
MalI GATC 1 cut(s) 154
MboI GATC 1 cut(s) 152
MboII GAAGA 2 cut(s) 35, 158
MflI RGATCY 1 cut(s) 152
MluCI AATT 4 cut(s) 111, 321, 330, 342
MmeI TCCRAC 2 cut(s) 158, 188
MnlI CCTC 1 cut(s) 262
Mph1103I ATGCAT 1 cut(s) 300
MseI TTAA 2 cut(s) 320, 329
Mva1269I GAATGC 1 cut(s) 298
NdeII GATC 1 cut(s) 152
NlaIII CATG 3 cut(s) 65, 140, 230
NsiI ATGCAT 1 cut(s) 300
PagI TCATGA 1 cut(s) 61
PctI GAATGC 1 cut(s) 298
PsuI RGATCY 1 cut(s) 152
RsaI GTAC 1 cut(s) 135
RsaNI GTAC 1 cut(s) 134
SaqAI TTAA 2 cut(s) 320, 329
Sau3AI GATC 1 cut(s) 152
SetI ASST 6 cut(s) 18, 35, 166, 175, 219, 273
SfaNI GCATC 2 cut(s) 136, 203
Sse9I AATT 4 cut(s) 111, 321, 330, 342
SspI AATATT 2 cut(s) 279, 316
SspMI CTAG 1 cut(s) 156
TaiI ACGT 2 cut(s) 35, 219
TasI AATT 4 cut(s) 111, 321, 330, 342
TatI WGTACW 1 cut(s) 133
Tru1I TTAA 2 cut(s) 320, 329
Tru9I TTAA 2 cut(s) 320, 329
XspI CTAG 1 cut(s) 156
Zsp2I ATGCAT 1 cut(s) 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.