pycom17g22280

gpi-anchored protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
20718321 .. 20718926
606 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 606 bp
ATGCACGGTATGGGTCTATACAGTTCGCCAGAAGCAGACACGGCCGAACAAGAAGCCAACACATTTGAAGACACAGAAGGGACGCCTGAAGAAGTGCCGAAGACCCAACCGACTCGTCAGTCCCTCAAGCCTCAAGGTAAAAAGGCATCAAAGAAAAAAGGTAGTTCTTCCAAAAATGACTACACTAAATATATGGAGGAACTTGCTCGCCAAGGTGAATTGAACATGGCATGGGAAAAGGCTAGAGATGAGGAAAAAGCTACTGCTATGGCAGCAATAATAGCAGCTACTGTGGCTCGTGATGCGGCGGCTGAGAGACAAAGAGAAATAGTTAATCGAGAGAACGAGATGATTAGAGAAGCACTTCATCGAGAGAATGAGATGCTTAGAGAAAAAAGGATGGCTCAAGCAGATCGTGACACTATGAACAAGTCTCTAGTAGGAATGTCTCCAAATTCAAAATATTTTTGGACATCAGAAAAAAGAGATGTCGTGCGAAGGAGGCGTGCAAGAGATGCCGAAACAAGTCAAGGGGGTTTAAGCTACAGAAATCCTAGCAACCAAGATCCTAGCACCACATATCCTAACTCCACATACTTTGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

202

Amino Acids

22.89

Weight (kDa)

7.86

Isoelectric Point (pI)

56.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000206)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04631 FvH4_1g14871 FvH4_3g18183 FvH4_4g07540 FvH4_4g11860 FvH4_4g12252 FvH4_4g14180 FvH4_4g24130 FvH4_5g15962 FvH4_5g21900 FvH4_5g34730 FvH4_5g38071 FvH4_6g38832 FvH4_7g00330 FvH4_7g07670 FvH4_7g08131 FvH4_7g29320
malus_domestica MD02G1308300.v1.1 MD03G1238900.v1.1 MD04G1103900.v1.1 MD08G1183800.v1.1 MD11G1096700.v1.1 MD11G1261300.v1.1 MD12G1048200.v1.1
pyrus_communis pycom01g07190 pycom01g17380 pycom02g05990 pycom02g17700 pycom02g17760 pycom02g17780 pycom03g02490 pycom03g07080 pycom03g08120 pycom03g11190 pycom03g11870 pycom03g16280 pycom04g02290 pycom04g05180 pycom04g07420 pycom04g10470 pycom04g10920 pycom04g11540 pycom05g00050 pycom05g04730 pycom05g04740 pycom05g07820 pycom05g13620 pycom05g19310 pycom06g03270 pycom06g08270 pycom06g09330 pycom06g20220 pycom07g08390 pycom07g22600 pycom08g09490 pycom08g13210 pycom08g14280 pycom08g15750 pycom08g18990 pycom08g21650 pycom09g01710 pycom09g03180 pycom09g09280 pycom09g10200 pycom09g11120 pycom09g11440 pycom10g02740 pycom10g07660 pycom10g09060 pycom10g20040 pycom111g01670 pycom11g08660 pycom11g09000 pycom11g12870 pycom11g14470 pycom11g15540 pycom11g19420 pycom11g22090 pycom12g10660 pycom12g11050 pycom12g12790 pycom12g14250 pycom13g14570 pycom13g26080 pycom14g00240 pycom15g10960 pycom15g24390 pycom15g31880 pycom15g32630 pycom15g33590 pycom16g07100 pycom16g09710 pycom16g20130 pycom16g21120 pycom17g02320 pycom17g11710 pycom17g14970 pycom17g19270 pycom17g22280 pycom17g23050 pycom17g25230
rosa_chinensis RchiOBHm_Chr7g0200361 RchiOBHm_Chr7g0226641
rosa_laevigata RLG00000030820
rosa_multiflora Rmu_sc0000129.1_g000009 Rmu_sc0000536.1_g000032 Rmu_sc0000663.1_g000015 Rmu_sc0000758.1_g000016 Rmu_sc0000857.1_g000019 Rmu_sc0001004.1_g000011 Rmu_sc0001096.1_g000018 Rmu_sc0001715.1_g000021 Rmu_sc0001781.1_g000006 Rmu_sc0002467.1_g000014 Rmu_sc0003018.1_g000003 Rmu_sc0003902.1_g000020 Rmu_sc0004048.1_g000013 Rmu_sc0005725.1_g000016 Rmu_sc0007871.1_g000002 Rmu_sc0008009.1_g000003 Rmu_sc0008223.1_g000013 Rmu_sc0008528.1_g000009 Rmu_sc0010621.1_g000003 Rmu_sc0010856.1_g000004 Rmu_sc0013113.1_g000005 Rmu_sc0016149.1_g000007 Rmu_ssc0000027.1_g000004 Rmu_ssc0000201.1_g000019
rosa_roxburghii Rroxscaffold_2G00109130 Rroxscaffold_3G00232550 Rroxscaffold_7G00176580
rosa_rugosa Rorug03G0276400 Rorug03G0276400
rosa_samantha Rh1CG005700 Rh2BG308900 Rh3BG239200 Rh4DG043100 Rh5AG498300 Rh5CG377400 Rh7BG373200 Rh7DG189000
rosa_wichuraiana Rw0G006950 Rw1G019470 Rw1G027440 Rw2G041930 Rw3G022370 Rw4G013430 Rw4G023110 Rw5G008510 Rw5G043680 Rw6G021680 Rw7G039660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 118
AciI CCGC 2 cut(s) 305, 308
AclWI GGATC 1 cut(s) 560
AcoI YGGCCR 1 cut(s) 42
AcsI RAATTY 1 cut(s) 454
AcuI CTGAAG 1 cut(s) 108
AcyI GRCGYC 1 cut(s) 83
AgsI TTSAA 3 cut(s) 68, 223, 459
AluBI AGCT 3 cut(s) 260, 287, 543
AluI AGCT 3 cut(s) 260, 287, 543
Alw26I GTCTC 3 cut(s) 310, 438, 453
AlwI GGATC 1 cut(s) 560
AlwNI CAGNNNCTG 1 cut(s) 290
AoxI GGCC 1 cut(s) 42
ApeKI GCWGC 2 cut(s) 272, 284
ApoI RAATTY 1 cut(s) 454
Asp700I GAANNNNTTC 1 cut(s) 363
AsuHPI GGTGA 1 cut(s) 227
BauI CACGAG 1 cut(s) 297
BbsI GAAGAC 2 cut(s) 75, 107
BbvI GCAGC 2 cut(s) 284, 296
BccI CCATC 1 cut(s) 394
BceAI ACGGC 1 cut(s) 57
BcoDI GTCTC 3 cut(s) 310, 438, 453
BfaI CTAG 4 cut(s) 243, 437, 555, 570
BfmI CTRYAG 1 cut(s) 544
BisI GCNGC 4 cut(s) 273, 285, 306, 309
BlsI GCNGC 4 cut(s) 274, 286, 307, 310
BmsI GCATC 4 cut(s) 155, 292, 372, 505
BpiI GAAGAC 2 cut(s) 75, 107
BpuEI CTTGAG 3 cut(s) 110, 117, 390
BsaHI GRCGYC 1 cut(s) 83
BsaJI CCNNGG 1 cut(s) 211
BseDI CCNNGG 1 cut(s) 211
BseGI GGATG 1 cut(s) 405
BseMII CTCAG 1 cut(s) 303
BseX3I CGGCCG 1 cut(s) 42
BseXI GCAGC 2 cut(s) 284, 296
Bsh1285I CGRYCG 1 cut(s) 45
BshFI GGCC 1 cut(s) 44
BsiEI CGRYCG 1 cut(s) 45
BslFI GGGAC 2 cut(s) 94, 106
BsmAI GTCTC 3 cut(s) 310, 438, 453
BsmFI GGGAC 2 cut(s) 94, 106
BsnI GGCC 1 cut(s) 44
Bsp143I GATC 2 cut(s) 412, 565
BspACI CCGC 2 cut(s) 305, 308
BspANI GGCC 1 cut(s) 44
BspCNI CTCAG 1 cut(s) 304
BspPI GGATC 1 cut(s) 560
BssECI CCNNGG 1 cut(s) 211
BssMI GATC 2 cut(s) 412, 565
BssNI GRCGYC 1 cut(s) 83
BssSI CACGAG 1 cut(s) 297
BssT1I CCWWGG 1 cut(s) 211
Bst2BI CACGAG 1 cut(s) 297
Bst4CI ACNGT 3 cut(s) 8, 23, 292
BstACI GRCGYC 1 cut(s) 83
BstAPI GCANNNNNTGC 1 cut(s) 515
BstC8I GCNNGC 2 cut(s) 208, 507
BstDEI CTNAG 2 cut(s) 312, 386
BstF5I GGATG 1 cut(s) 405
BstKTI GATC 2 cut(s) 415, 568
BstMAI GTCTC 3 cut(s) 310, 438, 453
BstMBI GATC 2 cut(s) 412, 565
BstMCI CGRYCG 1 cut(s) 45
BstMWI GCNNNNNNNGC 7 cut(s) 41, 272, 281, 293, 302, 502, 515
BstSFI CTRYAG 1 cut(s) 544
BstV1I GCAGC 2 cut(s) 284, 296
BstV2I GAAGAC 2 cut(s) 75, 107
BstX2I RGATCY 1 cut(s) 565
BstYI RGATCY 1 cut(s) 565
BstZI CGGCCG 1 cut(s) 42
BsuRI GGCC 1 cut(s) 44
BtsCI GGATG 1 cut(s) 405
Cac8I GCNNGC 2 cut(s) 208, 507
CaiI CAGNNNCTG 1 cut(s) 290
CseI GACGC 1 cut(s) 91
CspCI CAANNNNNGTGG 1 cut(s) 580
CviAII CATG 2 cut(s) 226, 231
DdeI CTNAG 2 cut(s) 312, 386
DpnI GATC 2 cut(s) 414, 567
DpnII GATC 2 cut(s) 412, 565
DrdI GACNNNNNNGTC 1 cut(s) 118
DseDI GACNNNNNNGTC 1 cut(s) 118
EaeI YGGCCR 1 cut(s) 42
EagI CGGCCG 1 cut(s) 42
EclXI CGGCCG 1 cut(s) 42
Eco130I CCWWGG 1 cut(s) 211
Eco52I CGGCCG 1 cut(s) 42
Eco57I CTGAAG 1 cut(s) 108
EcoT14I CCWWGG 1 cut(s) 211
ErhI CCWWGG 1 cut(s) 211
FaeI CATG 2 cut(s) 229, 234
FaqI GGGAC 2 cut(s) 94, 106
FatI CATG 2 cut(s) 225, 230
Fnu4HI GCNGC 4 cut(s) 273, 285, 306, 309
FokI GGATG 1 cut(s) 412
Fsp4HI GCNGC 4 cut(s) 273, 285, 306, 309
FspBI CTAG 4 cut(s) 243, 437, 555, 570
GluI GCNGC 4 cut(s) 273, 285, 306, 309
HaeIII GGCC 1 cut(s) 44
HgaI GACGC 1 cut(s) 91
Hin1I GRCGYC 1 cut(s) 83
Hin1II CATG 2 cut(s) 229, 234
HinfI GANTC 1 cut(s) 112
HphI GGTGA 1 cut(s) 227
Hpy188I TCNGA 1 cut(s) 478
Hpy188III TCNNGA 4 cut(s) 299, 338, 371, 416
HpyAV CCTTC 2 cut(s) 71, 492
HpyCH4III ACNGT 3 cut(s) 8, 23, 292
HpyCH4V TGCA 2 cut(s) 4, 509
HpyF10VI GCNNNNNNNGC 7 cut(s) 41, 272, 281, 293, 302, 502, 515
HpyF3I CTNAG 2 cut(s) 312, 386
Hsp92I GRCGYC 1 cut(s) 83
Hsp92II CATG 2 cut(s) 229, 234
Kzo9I GATC 2 cut(s) 412, 565
LpnPI CCDG 2 cut(s) 42, 99
Lsp1109I GCAGC 2 cut(s) 284, 296
LweI GCATC 4 cut(s) 155, 292, 372, 505
MaeI CTAG 4 cut(s) 243, 437, 555, 570
MaeIII GTNAC 1 cut(s) 416
MalI GATC 2 cut(s) 414, 567
MboI GATC 2 cut(s) 412, 565
MboII GAAGA 4 cut(s) 80, 101, 112, 159
MflI RGATCY 1 cut(s) 565
MluCI AATT 2 cut(s) 218, 454
MlyI GAGTC 1 cut(s) 106
MnlI CCTC 5 cut(s) 134, 141, 190, 244, 495
MroXI GAANNNNTTC 1 cut(s) 363
MseI TTAA 2 cut(s) 333, 539
MwoI GCNNNNNNNGC 7 cut(s) 41, 272, 281, 293, 302, 502, 515
NdeII GATC 2 cut(s) 412, 565
NlaIII CATG 2 cut(s) 229, 234
NmuCI GTSAC 1 cut(s) 416
PdmI GAANNNNTTC 1 cut(s) 363
PkrI GCNGC 4 cut(s) 274, 286, 307, 310
PleI GAGTC 1 cut(s) 106
PpsI GAGTC 1 cut(s) 106
PstNI CAGNNNCTG 1 cut(s) 290
PsuI RGATCY 1 cut(s) 565
SaqAI TTAA 2 cut(s) 333, 539
SatI GCNGC 4 cut(s) 273, 285, 306, 309
Sau3AI GATC 2 cut(s) 412, 565
SchI GAGTC 1 cut(s) 106
SetI ASST 6 cut(s) 139, 163, 217, 262, 289, 545
SfaNI GCATC 4 cut(s) 155, 292, 372, 505
SfcI CTRYAG 1 cut(s) 544
SmlI CTYRAG 3 cut(s) 125, 132, 405
SmoI CTYRAG 3 cut(s) 125, 132, 405
Sse9I AATT 2 cut(s) 218, 454
SsiI CCGC 2 cut(s) 305, 308
SspI AATATT 1 cut(s) 464
SspMI CTAG 4 cut(s) 243, 437, 555, 570
StyI CCWWGG 1 cut(s) 211
TaaI ACNGT 3 cut(s) 8, 23, 292
TaqI TCGA 2 cut(s) 337, 370
TasI AATT 2 cut(s) 218, 454
TauI GCSGC 2 cut(s) 308, 311
Tru1I TTAA 2 cut(s) 333, 539
Tru9I TTAA 2 cut(s) 333, 539
TseFI GTSAC 1 cut(s) 416
TseI GCWGC 2 cut(s) 272, 284
Tsp45I GTSAC 1 cut(s) 416
TspDTI ATGAA 2 cut(s) 356, 440
XapI RAATTY 1 cut(s) 454
XmnI GAANNNNTTC 1 cut(s) 363
XspI CTAG 4 cut(s) 243, 437, 555, 570
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.