Rmu_sc0001872.1_g000006

positive regulation of cell-substrate adhesion

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001872.1
Physical Location & Seq
Reverse (-)
31388 .. 40004
8617 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001872.1_g000006.1.cds

Sequence Viewer

Length: 7251 bp
atgtacttcatcatcttcctcatctgtattctcgttccttcttttcttcttcgttatcttaattttcttctaggacgtagtcctactgctgagtctccagcagattccacttgcaccccaataccaccttcaactcataaaccggaacatgagaaagttccagcactcgattccaccaacatccacttgggccattcatcatcatcttcttcctttggtttcgaacctgatcaggaacttccatcaaattccaccaacacacagctagtaccttcatcatctagatcttcttccatcgttaacttggaacatgaagcagtcacgggggattccccaaacaaccaagtagcaacatcatcatctggttcatcctctaactggcaacatgatgtcttcctcagttttaggggtgaggacacccgcaatagttttactgaccatttatactatgctatgaaccagagaggaatcgacacatttcgagatgctgaaaagcttcagagggggaaatccatttcatcagagcttctcaaagcaatcgaagagtccaagtttgcagttatagttctttcaaccaactatgctacttcaacttggtgtctggatgaacttgcacatattcttgaatgcaagaaactgagggaactggaagttcttcctgttttttataatgtagaaccatctgagataagaaagcaaactggaatatttggcaaggcattttctaagcatgagacaaatttcaagcacaatatcaagaaggtgaacaagtggagggaagctttaaaggatatagccggtctctcaggatggcatgtgacaaaagataggggagaatcagaagttattcaggatatagctaaaaggatttccaacatattgaacaacacgttatccaatcctgacagagatttaattggaatggatgcacgcatagaagcaattgagtcttacttggatctgaggtcagatgatatttgtaccatagggatttggggtatggggggcattggtaagacaactctggcaaaagaagttttcaaaaagattcgtaaccaatttgatactagcggctttgtttctgaagttagattgcattccgaaggaaaagctctagtagagttgcaaaagcttctttgtggatccttttttggggacagcaatataaatatagacacggttggaagagggatcaggttgttgaagaaggtattacataagaaaaaggtgcttattgttctagacgatgttgatgaattaaaacaactgaaagatttagctcctggaaagcatgatgaagagaattcttggggtccagggagtcgactcattataacaactagagataggcgcacattgacagaatgcggagtactagaaggaaaaatatatgaggttgaaaaactgagtgatgcggaagcttttcagctcatgtctcagaaagccttcaaggaaaactatccaccagatgagtttgtagagctgttgcagagttttgtacaatatgctagtggccttcctttagctcataaagtactagggtcatacttgtctggaagaagtataaatgaatggtcagaggcattggatagactcgatgaagatccggataatgacatttttagtgtgcttcaaataagttttgatggactaaaggagttagatcagaaaatctttttagacattgcttgtttcttcaatggcgaggatcatgctcgtgtaaaagggatattgaaaagttgtggcttttgtcctgaaatcggtataattgacctcattaataaatctctgattaaagttgaaaggaaaaaactgtggatgcatgatttactacaacaattgggttggcatattgttcgtcgagaatctcctttcccgggcaatcgtagcaggttgtggcttaatgacagtgccaacaagtacaaaggcagcaggtcatggcatgttgaggatactcgtgatgcactcactgaaaatacaggaacagctgctgttgaaggcttattcttaaacttgcttgaaaaagaagaaatgtggttgactagtgatccgttcttaaagatgcgcaacctaagactcttgaagatttgcaatgtgaactttcttaatgtcaactttacatatctctctaaaagattacggtttttggaatggcatgaatgtcctctggaaattttgtcatcttgttttgaaccagatcaacttgttgaattcaagatgcctaacagccgcattaaacaactatggaatgaaaggctttctctgaaaatgctagtactcatggatctttcggactgccaatatttaaccaagaccccggacttcagtaaggtcccaaagcttcagagattgatccttaaaggttgtaaagcgttatcggaggttcaccgaacaattggggatctccatcatttggttttattgaacttgaaaggttgtgaaagtctagagaaccttcctcaatccattgggttgagatctcttcgaacttttattctttcgggatgttcaaaactcggacactttccagagattgtggggaacatggatactttatcagaactttgtttagatggcacggctatattggagctacctgtatcaatccagcatttgggaggcgttattttgctagatctaagaggctgcaagaaccttctgagtcttcccagtgtcctttgcagtagtttgacgtcactgaaatttctctatctgtcattgtgctcaagtatggaagaactgccagaaaacataggctgcttgaaacacttggaggagcttgatgtatgtgatactgctataacaaaagtgcccaagtcaatttcaggcctcaagaatcttaaacttttgtgtttccatggatgctctagatccagaggtttagaactgccaaacttgttctcaggtttaagatctttgacaacactaaacctaggcggatgcaaccttgcagcaatcccgggtgacattggcgaattaagctcactgcagagtttggatttaagtgaaaacaacttttccactatacctcagagcatctctcatctttctgagcttacagaaatttctttgtttaagtgtagcaatctacagttgttgccaaaagaatttccatcgagtttaagaaatgtggacgtacgttattgtcatatgctgaaaagttcctcagatggttggagaaaatgggcttctcgaaagggtttgagtatcataaattgtcgaagaccagaggaggatgaacatttgtcaaagctacctgaactccctaagttccctttgaaacaactgcaacaactcaatctttccaactgccaacacctgaccaagatcccggagttgaatgagatgccatatattcagaaattgatccttgaaggttgtgaacaattatcagaggttcacacaacaattgggagcctacaatttctggttttattgaatttgaaaggttgcacaagtctagagagccttcctcaatccatcagcttgagatatcttcgcacttttattctttcgggatgctcaaaacttagagagtttccggagattatggtgaacatggatagtttatcagaactttatttagatggcacggctctacgggagctgcctgtatcaatccagcatttgaacggccttactttgctaaatctaagtggctgcaggaacctttcaactgttccagtgcttccaagtctaaaatctctcaatctgtcaggttgctcccgtatatctagattgccaacagacctgggaagaatggaacatttggaggagcttgatgcctctgaaactgctataactgaagtaccctattccattttatatttggagaagctcaaagtgttatctttctgtggatgttttggtttgcagttacctaactggttctcgaatttacgatctttgagatcattagatctacgtaaatgtggtctaccagaaaatgttcatgataggctcttttggttgacttcactgcagagtttggatttgggtgaaaacagttttgtgagtatacctaatgaaattggtctactatcctctttgcagagattggatttcagtggaaacaatttggtgagtgtatcaaatgaaattggttccttatcctctttgcagtgcttggatttgagtgaaaacaactttgtgagtatacctgaaagcatctctcaactttctgagcttacagaacttcgcttgtttaggtgtagtaagctacagtcactgccaagaaatcttccattcaatctaaaacatgtcaatgcacgagaatgtcccatgttgaagaataatgcagatactttgacaatatgggcttctgggaagcggttctgtttcataaattgtggacaattagaccaggataatgatcagccaagccacgttccagttccagataatgatcagccaagccacgttccagttccagttccggaagaccgtattggactactcttttctaaatacattcaggatcgaatctatggtaaaaaaccatttgaatttcgttttccacatagtacaaggattccccaattgtggagtcattggagaagtggcccttctgtggcagtcccgctatctgatactaacagttcatggattggacttgctctatttgttgttttcgaaatccttgagaaagaaaaatttgataacagttgggaatcagaggagaccatctgtgaatttcacaccaatcatgggcgtgaaagttcactagtttttcaaaacttcctagacttcaggactggttcatatggactttgttgctacgaaccacgaggtgggcaatttggtgggttgtttgatgaaccactacttcaagcttcagtttcaacaaagagaccagatttgaaagtgagaggttgtgggttgcatctgatatcagagcatgatgctgcagagtttgttcaaaatttaataaaccagactgctattcaacacctggacttcaattttgatcgacattgtgaggaaatattagaaaaggcaacgatttgtgacctgatagagctagaccctgatgatctatgggaactaggatctacttcaactgtgaatgaagatgactgccgcatcagtagctgtaaaatccaactcagagcacagctgtcaatcctctatgagggacgcaatggatgtgagaagagtttccatgtttgtcttcctgattcaccaaatataatgtcaattccgacctggttcatcaatcgccaagcaggtgatgtaacactatgttacattagtgaaaacttatttgctgatcagagatgggtgggattagaactatatgttgtatttgcccggcgtacacctgctccaagtgatggccatattaatagttttttctttcatgttgagttgtgtggtcatgataatggaagtctaacaatgcatggatccctcaagagagagagttgtcttggagagtcaaatcaacttcttgtattgcatttaccacgtgtttattttcaagaacagtttaatcaatgtcaggttattagcgcgttgtttaccaccagtaccccagaattggaggttatagtgtgtggtagccgtttagtttatcagcaagatttgaaagacttgatccattcattgactgcggctgcaagcacttttggggaacatgtcctcactcaactttgttcccaggcctgcacccaaactgatgatcagatcattgcagtgaaaggagacatggccatcaattgcgattcctcatttcaaagcagaagtacagcacaattgcccgaacaagttcttacttcaataatgcggctgaaaagttacagatgctatcttcggcaaaagcaagtttttgtagagtctgaacctaccccattagttcactccggatcagtgataccagtccatgccaaaggctgtcttttggaatacagggaaagcaactcagaaaatgtagcagaagaagacacaaagtcgtcattggcttattgtcatcatatacgtataatggctgagactcaactttacggacgctatagttcatttcagttgaaaacatccctccagttgttacttcaacactccaaggtggccgctctgtgtcttggtggacatacaatttcttctctcaagaattttgatccttcctctgcatgcaatattatttgtttctctgacaaggaaattccagtctggttcaaacatgagatgtcttatcaactgtcttctaggtccagggtgggaatcaaactacctccaaaattgctggaggatgggaattggagaggacttgctatatgtgttgcctttgaagttcatgaccagcgtccaactacctccccggtcaaacttctctgtcacttgagagcaaaggacaactattgcttgaatcctatccctatgtgtccaatcactgaagagaaactcaagtcgttgcatgttgatagattcatttggctaagctacatcccccgtgttttgctaacagagttcaatgtggttagtgatgtagaggccagaatttatgttagttgcaaaggcttgacagtggagaagtgtggtatccgtctcttgtaccggcaagaagagggggagtttgagagcgtgataaccgagtgctggacctctttctttgataatctgtctttcatccgtagacttgtagaagcagatgatcaaaatgttccaccacggacaaggcatgaacttccaatgcttgaagggcatatcaaggtctttgatccggatatactatataatgcaattcccacttctactgaaattccgaagtggttcgggaatcccattgaggccaagtatgacgattacgcctatgcccgcacgtgggaattccagttaccaccatctttgagtgacaaaaactggataggattggctatctgtgcatcacattgtattagcagagcgtatttggtggaacgtgattcctacccctttattttaagattgaaaactggaaacaatggcttgtcatctctccatcggtatcagatgaacaatgaagaatctgagttcctaaagcgttgttgtaatgtgcatggtgaattcatttggctctcctacataccacgacgctggtttctacatcagctaaatgacgagtctgtcctcattgttttatctggtgtgaactgctggaggctgggcacgttatatctccgttttgtgtatgcgcatgaggtggaagagtttaagcagctctgtttcaatcttcatcgaccccttgcctgcccaacactaaaaagatcaggatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

2416

Amino Acids

273.55

Weight (kDa)

5.98

Isoelectric Point (pI)

49.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000307)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g16600 FvH4_1g16610 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16621 FvH4_1g16630 FvH4_1g16640 FvH4_1g16640 FvH4_1g16650 FvH4_1g16650 FvH4_3g27631 FvH4_4g11392 FvH4_4g11542
prunus_persica Prupe.4G224500_v2.0.a1 Prupe.4G226900_v2.0.a1 Prupe.4G227000_v2.0.a1
pyrus_communis pycom11g18180 pycom11g18210 pycom11g18230 pycom11g18270 pycom11g18350 pycom11g18360 pycom11g18370
rosa_chinensis RchiOBHm_Chr2g0106511 RchiOBHm_Chr2g0106541 RchiOBHm_Chr2g0106551 RchiOBHm_Chr2g0106571 RchiOBHm_Chr2g0124621 RchiOBHm_Chr6g0251591 RchiOBHm_Chr6g0251631 RchiOBHm_Chr6g0251641
rosa_laevigata RLG00000015443 RLG00000015444 RLG00000015458 RLG00000017510 RLG00000017511 RLG00000017512 RLG00000017515 RLG00000017516 RLG00000017517 RLG00000018809 RLG00000020934 RLG00000020935 RLG00000034092
rosa_multiflora Rmu_co8285777.1_g000001 Rmu_sc0000762.1_g000001 Rmu_sc0001872.1_g000006 Rmu_sc0005255.1_g000019 Rmu_sc0005597.1_g000006 Rmu_sc0012104.1_g000001 Rmu_sc0017105.1_g000011 Rmu_sc0022904.1_g000001 Rmu_ssc0000135.1_g000049 Rmu_ssc0000213.1_g000047
rosa_roxburghii Rroxscaffold_2G00092830 Rroxscaffold_2G00119790 Rroxscaffold_2G00137010 Rroxscaffold_2G00137030 Rroxscaffold_2G00137070 Rroxscaffold_7G00216560
rosa_rugosa Rorug02G0136100 Rorug02G0136200 Rorug02G0136300 Rorug02G0136400 Rorug02G0251800 Rorug02G0251800 Rorug02G0455500 Rorug02G0455600 Rorug02G0455700 Rorug05G0195300
rosa_samantha Rh2AG187400 Rh2AG187500 Rh2AG187600 Rh2AG310500 Rh2BG198200 Rh2BG198300 Rh2BG198400 Rh2BG198600 Rh2BG318900 Rh2BG534300 Rh2CG192400 Rh2CG192500 Rh2CG192600 Rh2CG297500 Rh2DG193500 Rh2DG193600 Rh2DG193800 Rh2DG334200 Rh2DG543100 Rh5AG280400 Rh5BG285800 Rh5BG285900 Rh5CG317900 Rh5CG318000 Rh5DG294600 Rh5DG294700 Rh6AG012200 Rh6AG012700 Rh6BG011200 Rh6BG011700
rosa_wichuraiana Rw0G009380 Rw2G014610 Rw2G014630 Rw2G014640 Rw2G014680 Rw2G025120 Rw2G043000 Rw5G026490 Rw6G001370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 669, 1334
AarI CACCTGC 2 cut(s) 5216, 5329
AasI GACNNNNNNGTC 1 cut(s) 7100
AatII GACGTC 1 cut(s) 2696
Acc16I TGCGCA 2 cut(s) 2066, 7170
Acc36I ACCTGC 4 cut(s) 1881, 1923, 5216, 5329
AccB7I CCANNNNNTGG 4 cut(s) 2413, 2614, 4790, 5333
AccBSI CCGCTC 1 cut(s) 6071
AccI GTMKAC 6 cut(s) 1324, 3937, 4018, 4036, 4156, 6631
AccII CGCG 1 cut(s) 5513
AccIII TCCGGA 5 cut(s) 1606, 3541, 4435, 5861, 6718
AcoI YGGCCR 3 cut(s) 5335, 5709, 6066
AcuI CTGAAG 8 cut(s) 482, 1104, 2308, 2327, 3825, 4732, 4818, 6411
AcvI CACGTG 2 cut(s) 5468, 6819
AcyI GRCGYC 1 cut(s) 2693
AdeI CACNNNGTG 1 cut(s) 4790
AflIII ACRYGT 4 cut(s) 888, 4258, 5467, 5635
AhdI GACNNNNNGTC 1 cut(s) 5947
AhlI ACTAGT 2 cut(s) 2042, 4723
AjnI CCWGG 8 cut(s) 1282, 1315, 3750, 4362, 4950, 5204, 5658, 6209
AjuI GAANNNNNNNTTGG 4 cut(s) 112, 144, 4431, 4463
Alw21I GWGCWC 2 cut(s) 2726, 5113
Alw26I GTCTC 9 cut(s) 99, 728, 806, 1440, 4673, 4843, 5697, 5984, 6548
AlwNI CAGNNNCTG 3 cut(s) 1991, 4228, 5091
Ama87I CYCGRG 2 cut(s) 1876, 2959
Aor13HI TCCGGA 5 cut(s) 1606, 3541, 4435, 5861, 6718
ArsI GACNNNNNNTTYG 4 cut(s) 4946, 4978, 5177, 5209
AseI ATTAAT 2 cut(s) 1779, 5343
AspA2I CCTAGG 1 cut(s) 2932
AspLEI GCGC 4 cut(s) 1353, 2067, 5513, 7171
AspS9I GGNCC 6 cut(s) 190, 1313, 2332, 4562, 6207, 6597
AsuC2I CCSGG 8 cut(s) 1877, 1878, 2318, 2960, 2961, 3332, 5311, 6317
AsuII TTCGAA 3 cut(s) 222, 2485, 4632
AvaI CYCGRG 2 cut(s) 1876, 2959
AvaII GGWCC 4 cut(s) 1313, 2332, 6207, 6597
AvrII CCTAGG 1 cut(s) 2932
BaeGI GKGCMC 2 cut(s) 2814, 7145
BaeI ACNNNNGTAYC 2 cut(s) 3792, 3825
BalI TGGCCA 2 cut(s) 5337, 5711
BamHI GGATCC 2 cut(s) 1142, 5405
BauI CACGAG 4 cut(s) 1716, 1956, 4269, 4785
BbrPI CACGTG 2 cut(s) 5468, 6819
BbsI GAAGAC 7 cut(s) 385, 2657, 3229, 4446, 5162, 5946, 6192
Bbv12I GWGCWC 2 cut(s) 2726, 5113
BceAI ACGGC 4 cut(s) 2595, 3609, 3649, 5547
BcgI CGANNNNNNTGC 4 cut(s) 1694, 1728, 1838, 1872
BciT130I CCWGG 8 cut(s) 1284, 1317, 3752, 4364, 4952, 5206, 5660, 6211
BciVI GTATCC 3 cut(s) 1945, 2542, 6548
BclI TGATCA 6 cut(s) 229, 4372, 4405, 5269, 5680, 6649
BcnI CCSGG 8 cut(s) 1877, 1878, 2318, 2960, 2961, 3332, 5311, 6317
BcoDI GTCTC 9 cut(s) 99, 728, 806, 1440, 4673, 4843, 5697, 5984, 6548
BcuI ACTAGT 2 cut(s) 2042, 4723
BfmI CTRYAG 7 cut(s) 2987, 3089, 3661, 3980, 4220, 4905, 6010
BfuAI ACCTGC 4 cut(s) 1881, 1923, 5216, 5329
BfuI GTATCC 3 cut(s) 1945, 2542, 6548
BglII AGATCT 5 cut(s) 284, 2477, 2635, 2912, 3919
BlnI CCTAGG 1 cut(s) 2932
BlpI GCTNAGC 1 cut(s) 6434
BmcAI AGTACT 3 cut(s) 1374, 1536, 2277
Bme18I GGWCC 4 cut(s) 1313, 2332, 6207, 6597
BmeRI GACNNNNNGTC 1 cut(s) 5947
BmeT110I CYCGRG 2 cut(s) 1876, 2959
BmgT120I GGNCC 6 cut(s) 190, 1313, 2332, 4562, 6207, 6597
BmiI GGNNCC 7 cut(s) 1144, 1314, 2334, 3416, 3668, 4105, 5407
BmrI ACTGGG 1 cut(s) 2664
BmuI ACTGGG 1 cut(s) 2664
BoxI GACNNNNGTC 1 cut(s) 6300
BpiI GAAGAC 7 cut(s) 385, 2657, 3229, 4446, 5162, 5946, 6192
BplI GAGNNNNNCTC 4 cut(s) 3025, 3057, 3457, 3489
BpmI CTGGAG 4 cut(s) 81, 6023, 6263, 7153
Bpu1102I GCTNAGC 1 cut(s) 6434
Bpu14I TTCGAA 3 cut(s) 222, 2485, 4632
BpuEI CTTGAG 8 cut(s) 2710, 2816, 3508, 4661, 5396, 6089, 6358, 6386
BpuMI CCSGG 8 cut(s) 1877, 1878, 2318, 2960, 2961, 3332, 5311, 6317
BsaAI YACGTR 4 cut(s) 3926, 5468, 5978, 6819
BsaBI GATNNNNATC 4 cut(s) 1602, 2406, 4371, 4404
BsaHI GRCGYC 1 cut(s) 2693
BsaI GGTCTC 3 cut(s) 806, 4673, 4843
BsaWI WCCGGW 6 cut(s) 142, 1606, 3541, 4435, 5861, 6718
BsaXI ACNNNNNCTCC 4 cut(s) 3246, 3276, 5308, 5338
Bse118I RCCGGY 2 cut(s) 797, 6552
Bse3DI GCAATG 4 cut(s) 1683, 2098, 5146, 5688
Bse8I GATNNNNATC 4 cut(s) 1602, 2406, 4371, 4404
BseAI TCCGGA 5 cut(s) 1606, 3541, 4435, 5861, 6718
BseBI CCWGG 8 cut(s) 1284, 1317, 3752, 4364, 4952, 5206, 5660, 6211
BseJI GATNNNNATC 4 cut(s) 1602, 2406, 4371, 4404
BseMI GCAATG 4 cut(s) 1683, 2098, 5146, 5688
BseRI GAGGAG 4 cut(s) 2789, 3245, 3788, 4691
BseSI GKGCMC 2 cut(s) 2814, 7145
BseYI CCCAGC 1 cut(s) 7138
BsgI GTGCAG 1 cut(s) 5650
Bsh1236I CGCG 1 cut(s) 5513
BsiHKAI GWGCWC 2 cut(s) 2726, 5113
BsiHKCI CYCGRG 2 cut(s) 1876, 2959
BsiWI CGTACG 1 cut(s) 3136
BslFI GGGAC 5 cut(s) 1169, 2318, 4263, 4562, 5148
BsmAI GTCTC 9 cut(s) 99, 728, 806, 1440, 4673, 4843, 5697, 5984, 6548
BsmBI CGTCTC 1 cut(s) 6548
BsmFI GGGAC 5 cut(s) 1169, 2318, 4263, 4562, 5148
BsmI GAATGC 3 cut(s) 632, 1096, 1370
Bso31I GGTCTC 3 cut(s) 806, 4673, 4843
BsoBI CYCGRG 2 cut(s) 1876, 2959
Bsp119I TTCGAA 3 cut(s) 222, 2485, 4632
Bsp1286I GDGCHC 4 cut(s) 2726, 2814, 5113, 7145
Bsp13I TCCGGA 5 cut(s) 1606, 3541, 4435, 5861, 6718
Bsp1407I TGTACA 1 cut(s) 1498
Bsp1720I GCTNAGC 1 cut(s) 6434
Bsp19I CCATGG 1 cut(s) 2857
BspEI TCCGGA 5 cut(s) 1606, 3541, 4435, 5861, 6718
BspFNI CGCG 1 cut(s) 5513
BspHI TCATGA 3 cut(s) 3952, 5377, 6292
BspLI GGNNCC 7 cut(s) 1144, 1314, 2334, 3416, 3668, 4105, 5407
BspMAI CTGCAG 4 cut(s) 2991, 3665, 3984, 4909
BspMI ACCTGC 4 cut(s) 1881, 1923, 5216, 5329
BspT104I TTCGAA 3 cut(s) 222, 2485, 4632
BspTNI GGTCTC 3 cut(s) 806, 4673, 4843
BsrBI CCGCTC 1 cut(s) 6071
BsrDI GCAATG 4 cut(s) 1683, 2098, 5146, 5688
BsrFI RCCGGY 2 cut(s) 797, 6552
BsrGI TGTACA 1 cut(s) 1498
BssAI RCCGGY 2 cut(s) 797, 6552
BssNAI GTATAC 2 cut(s) 4019, 4157
BssNI GRCGYC 1 cut(s) 2693
BssSI CACGAG 4 cut(s) 1716, 1956, 4269, 4785
BssT1I CCWWGG 3 cut(s) 2857, 2932, 6060
Bst1107I GTATAC 2 cut(s) 4019, 4157
Bst2BI CACGAG 4 cut(s) 1716, 1956, 4269, 4785
Bst2UI CCWGG 8 cut(s) 1284, 1317, 3752, 4364, 4952, 5206, 5660, 6211
Bst6I CTCTTC 8 cut(s) 537, 1180, 1293, 2487, 5147, 6387, 6555, 7176
BstACI GRCGYC 1 cut(s) 2693
BstAUI TGTACA 1 cut(s) 1498
BstBAI YACGTR 4 cut(s) 3926, 5468, 5978, 6819
BstBI TTCGAA 3 cut(s) 222, 2485, 4632
BstC8I GCNNGC 6 cut(s) 931, 5620, 5665, 6130, 6814, 7225
BstDSI CCRYGG 2 cut(s) 2857, 6665
BstENI CCTNNNNNAGG 1 cut(s) 5129
BstFNI CGCG 1 cut(s) 5513
BstHHI GCGC 4 cut(s) 1353, 2067, 5513, 7171
BstMAI GTCTC 9 cut(s) 99, 728, 806, 1440, 4673, 4843, 5697, 5984, 6548
BstMWI GCNNNNNNNGC 5 cut(s) 1887, 2979, 5088, 6697, 6878
BstNI CCWGG 8 cut(s) 1284, 1317, 3752, 4364, 4952, 5206, 5660, 6211
BstNSI RCATGY 6 cut(s) 818, 1946, 4262, 5639, 6132, 6416
BstPAI GACNNNNGTC 1 cut(s) 6300
BstSFI CTRYAG 7 cut(s) 2987, 3089, 3661, 3980, 4220, 4905, 6010
BstSLI GKGCMC 2 cut(s) 2814, 7145
BstSNI TACGTA 2 cut(s) 3926, 5978
BstUI CGCG 1 cut(s) 5513
BstV2I GAAGAC 7 cut(s) 385, 2657, 3229, 4446, 5162, 5946, 6192
BstXI CCANNNNNNTGG 1 cut(s) 7071
BstZ17I GTATAC 2 cut(s) 4019, 4157
BsuI GTATCC 3 cut(s) 1945, 2542, 6548
BtgI CCRYGG 2 cut(s) 2857, 6665
BtsI GCAGTG 5 cut(s) 2984, 3977, 4127, 4226, 5700
BveI ACCTGC 4 cut(s) 1881, 1923, 5216, 5329
Cac8I GCNNGC 6 cut(s) 931, 5620, 5665, 6130, 6814, 7225
CaiI CAGNNNCTG 3 cut(s) 1991, 4228, 5091
CciI TCATGA 3 cut(s) 3952, 5377, 6292
CfoI GCGC 4 cut(s) 1353, 2067, 5513, 7171
Cfr10I RCCGGY 2 cut(s) 797, 6552
Cfr13I GGNCC 6 cut(s) 190, 1313, 2332, 4562, 6207, 6597
Cfr9I CCCGGG 2 cut(s) 1876, 2959
CseI GACGC 4 cut(s) 5145, 6015, 6290, 7077
CsiI ACCWGGT 1 cut(s) 5204
CspCI CAANNNNNGTGG 2 cut(s) 6825, 6860
DraI TTTAAA 1 cut(s) 786
DraIII CACNNNGTG 1 cut(s) 4790
DrdI GACNNNNNNGTC 1 cut(s) 7100
DriI GACNNNNNGTC 1 cut(s) 5947
DseDI GACNNNNNNGTC 1 cut(s) 7100
EaeI YGGCCR 3 cut(s) 5335, 5709, 6066
Eam1104I CTCTTC 8 cut(s) 537, 1180, 1293, 2487, 5147, 6387, 6555, 7176
Eam1105I GACNNNNNGTC 1 cut(s) 5947
EarI CTCTTC 8 cut(s) 537, 1180, 1293, 2487, 5147, 6387, 6555, 7176
EciI GGCGGA 1 cut(s) 2952
Eco105I TACGTA 2 cut(s) 3926, 5978
Eco130I CCWWGG 3 cut(s) 2857, 2932, 6060
Eco147I AGGCCT 2 cut(s) 2829, 5663
Eco31I GGTCTC 3 cut(s) 806, 4673, 4843
Eco32I GATATC 2 cut(s) 3494, 4890
Eco47I GGWCC 4 cut(s) 1313, 2332, 6207, 6597
Eco57I CTGAAG 8 cut(s) 482, 1104, 2308, 2327, 3825, 4732, 4818, 6411
Eco72I CACGTG 2 cut(s) 5468, 6819
Eco88I CYCGRG 2 cut(s) 1876, 2959
EcoNI CCTNNNNNAGG 1 cut(s) 5129
EcoO109I RGGNCCY 1 cut(s) 2332
EcoRI GAATTC 4 cut(s) 1303, 2210, 6824, 7040
EcoRII CCWGG 8 cut(s) 1282, 1315, 3750, 4362, 4950, 5204, 5658, 6209
EcoRV GATATC 2 cut(s) 3494, 4890
EcoT14I CCWWGG 3 cut(s) 2857, 2932, 6060
EcoT22I ATGCAT 2 cut(s) 1824, 5403
ErhI CCWWGG 3 cut(s) 2857, 2932, 6060
Esp3I CGTCTC 1 cut(s) 6548
FalI AAGNNNNNCTT 4 cut(s) 4549, 4581, 5880, 5912
FaqI GGGAC 5 cut(s) 1169, 2318, 4263, 4562, 5148
FauI CCCGC 3 cut(s) 428, 4587, 6821
FauNDI CATATG 2 cut(s) 3150, 4762
FbaI TGATCA 6 cut(s) 229, 4372, 4405, 5269, 5680, 6649
FblI GTMKAC 6 cut(s) 1324, 3937, 4018, 4036, 4156, 6631
FspAI RTGCGCAY 1 cut(s) 7170
FspI TGCGCA 2 cut(s) 2066, 7170
GlaI GCGC 4 cut(s) 1352, 2066, 5512, 7170
GsaI CCCAGC 1 cut(s) 7142
GsuI CTGGAG 4 cut(s) 81, 6023, 6263, 7153
HgaI GACGC 4 cut(s) 5145, 6015, 6290, 7077
HhaI GCGC 4 cut(s) 1353, 2067, 5513, 7171
Hin1I GRCGYC 1 cut(s) 2693
Hin6I GCGC 4 cut(s) 1351, 2065, 5511, 7169
HinP1I GCGC 4 cut(s) 1351, 2065, 5511, 7169
HincII GTYRAC 5 cut(s) 301, 1325, 2040, 2113, 3972
HindII GTYRAC 5 cut(s) 301, 1325, 2040, 2113, 3972
HindIII AAGCTT 6 cut(s) 494, 780, 1130, 1419, 2339, 4830
HpaI GTTAAC 1 cut(s) 301
Hpy99I CGWCG 2 cut(s) 1863, 7071
HpyF10VI GCNNNNNNNGC 5 cut(s) 1887, 2979, 5088, 6697, 6878
Hsp92I GRCGYC 1 cut(s) 2693
HspAI GCGC 4 cut(s) 1351, 2065, 5511, 7169
Kpn2I TCCGGA 5 cut(s) 1606, 3541, 4435, 5861, 6718
Ksp22I TGATCA 6 cut(s) 229, 4372, 4405, 5269, 5680, 6649
KspAI GTTAAC 1 cut(s) 301
LmnI GCTCC 8 cut(s) 1285, 2590, 2776, 3414, 3604, 3728, 3775, 5329
MabI ACCWGGT 1 cut(s) 5204
MbiI CCGCTC 1 cut(s) 6071
MfeI CAATTG 7 cut(s) 942, 1838, 2394, 3408, 4538, 5716, 5753
MhlI GDGCHC 4 cut(s) 2726, 2814, 5113, 7145
MlsI TGGCCA 2 cut(s) 5337, 5711
MluNI TGGCCA 2 cut(s) 5337, 5711
MmeI TCCRAC 7 cut(s) 897, 1162, 3155, 3330, 5125, 5225, 6329
Mox20I TGGCCA 2 cut(s) 5337, 5711
Mph1103I ATGCAT 2 cut(s) 1824, 5403
MroI TCCGGA 5 cut(s) 1606, 3541, 4435, 5861, 6718
MscI TGGCCA 2 cut(s) 5337, 5711
MslI CAYNNNNRTG 6 cut(s) 1716, 4263, 4273, 4710, 5382, 5693
Msp20I TGGCCA 2 cut(s) 5337, 5711
MspA1I CMGCKG 2 cut(s) 1988, 5116
MunI CAATTG 7 cut(s) 942, 1838, 2394, 3408, 4538, 5716, 5753
Mva1269I GAATGC 3 cut(s) 632, 1096, 1370
MvaI CCWGG 8 cut(s) 1284, 1317, 3752, 4364, 4952, 5206, 5660, 6211
MvnI CGCG 1 cut(s) 5513
MwoI GCNNNNNNNGC 5 cut(s) 1887, 2979, 5088, 6697, 6878
NciI CCSGG 8 cut(s) 1877, 1878, 2318, 2960, 2961, 3332, 5311, 6317
NcoI CCATGG 1 cut(s) 2857
NdeI CATATG 2 cut(s) 3150, 4762
NlaIV GGNNCC 7 cut(s) 1144, 1314, 2334, 3416, 3668, 4105, 5407
NmuCI GTSAC 8 cut(s) 319, 817, 2694, 2963, 4224, 5006, 6332, 6848
NsbI TGCGCA 2 cut(s) 2066, 7170
NsiI ATGCAT 2 cut(s) 1824, 5403
NspI RCATGY 6 cut(s) 818, 1946, 4262, 5639, 6132, 6416
NspV TTCGAA 3 cut(s) 222, 2485, 4632
PaeI GCATGC 1 cut(s) 6132
PagI TCATGA 3 cut(s) 3952, 5377, 6292
PaqCI CACCTGC 2 cut(s) 5216, 5329
PceI AGGCCT 2 cut(s) 2829, 5663
PciI ACATGT 2 cut(s) 4258, 5635
PctI GAATGC 3 cut(s) 632, 1096, 1370
Pfl23II CGTACG 1 cut(s) 3136
PflFI GACNNNGTC 1 cut(s) 78
PflMI CCANNNNNTGG 4 cut(s) 2413, 2614, 4790, 5333
PfoI TCCNGGA 2 cut(s) 1282, 3330
PmaCI CACGTG 2 cut(s) 5468, 6819
PmlI CACGTG 2 cut(s) 5468, 6819
Ppu21I YACGTR 4 cut(s) 3926, 5468, 5978, 6819
PpuMI RGGWCCY 1 cut(s) 2332
PscI ACATGT 2 cut(s) 4258, 5635
PshAI GACNNNNGTC 1 cut(s) 6300
PshBI ATTAAT 2 cut(s) 1779, 5343
PsiI TTATAA 2 cut(s) 669, 1334
Psp5II RGGWCCY 1 cut(s) 2332
Psp6I CCWGG 8 cut(s) 1282, 1315, 3750, 4362, 4950, 5204, 5658, 6209
PspCI CACGTG 2 cut(s) 5468, 6819
PspFI CCCAGC 1 cut(s) 7138
PspGI CCWGG 8 cut(s) 1282, 1315, 3750, 4362, 4950, 5204, 5658, 6209
PspLI CGTACG 1 cut(s) 3136
PspN4I GGNNCC 7 cut(s) 1144, 1314, 2334, 3416, 3668, 4105, 5407
PspPI GGNCC 6 cut(s) 190, 1313, 2332, 4562, 6207, 6597
PspPPI RGGWCCY 1 cut(s) 2332
PstI CTGCAG 4 cut(s) 2991, 3665, 3984, 4909
PstNI CAGNNNCTG 3 cut(s) 1991, 4228, 5091
PsyI GACNNNGTC 1 cut(s) 78
PvuII CAGCTG 2 cut(s) 1988, 5116
RseI CAYNNNNRTG 6 cut(s) 1716, 4263, 4273, 4710, 5382, 5693
SalI GTCGAC 1 cut(s) 1323
Sau96I GGNCC 6 cut(s) 190, 1313, 2332, 4562, 6207, 6597
ScaI AGTACT 3 cut(s) 1374, 1536, 2277
SduI GDGCHC 4 cut(s) 2726, 2814, 5113, 7145
SexAI ACCWGGT 1 cut(s) 5204
SfcI CTRYAG 7 cut(s) 2987, 3089, 3661, 3980, 4220, 4905, 6010
SfuI TTCGAA 3 cut(s) 222, 2485, 4632
SinI GGWCC 4 cut(s) 1313, 2332, 6207, 6597
SmaI CCCGGG 2 cut(s) 1878, 2961
SmiMI CAYNNNNRTG 6 cut(s) 1716, 4263, 4273, 4710, 5382, 5693
SmlI CTYRAG 8 cut(s) 2725, 2831, 3487, 4640, 5411, 6104, 6337, 6401
SmoI CTYRAG 8 cut(s) 2725, 2831, 3487, 4640, 5411, 6104, 6337, 6401
SnaBI TACGTA 2 cut(s) 3926, 5978
SpeI ACTAGT 2 cut(s) 2042, 4723
SphI GCATGC 1 cut(s) 6132
SseBI AGGCCT 2 cut(s) 2829, 5663
SspI AATATT 4 cut(s) 708, 2303, 4986, 6136
StuI AGGCCT 2 cut(s) 2829, 5663
StyI CCWWGG 3 cut(s) 2857, 2932, 6060
TatI WGTACW 8 cut(s) 3, 1372, 1498, 1534, 1920, 2275, 4523, 5744
TauI GCSGC 6 cut(s) 1074, 2232, 5082, 5615, 5788, 6071
TseFI GTSAC 8 cut(s) 319, 817, 2694, 2963, 4224, 5006, 6332, 6848
Tsp45I GTSAC 8 cut(s) 319, 817, 2694, 2963, 4224, 5006, 6332, 6848
TspGWI ACGGA 6 cut(s) 2040, 6018, 6530, 6617, 6682, 7145
TspMI CCCGGG 2 cut(s) 1876, 2959
Tth111I GACNNNGTC 1 cut(s) 78
Van91I CCANNNNNTGG 4 cut(s) 2413, 2614, 4790, 5333
VpaK11BI GGWCC 4 cut(s) 1313, 2332, 6207, 6597
VspI ATTAAT 2 cut(s) 1779, 5343
XagI CCTNNNNNAGG 1 cut(s) 5129
XbaI TCTAGA 6 cut(s) 281, 1240, 2446, 2867, 3460, 3734
XceI RCATGY 6 cut(s) 818, 1946, 4262, 5639, 6132, 6416
XcmI CCANNNNNNNNNTGG 3 cut(s) 184, 301, 3826
XmaI CCCGGG 2 cut(s) 1876, 2959
XmaJI CCTAGG 1 cut(s) 2932
XmiI GTMKAC 6 cut(s) 1324, 3937, 4018, 4036, 4156, 6631
ZraI GACGTC 1 cut(s) 2694
ZrmI AGTACT 3 cut(s) 1374, 1536, 2277
Zsp2I ATGCAT 2 cut(s) 1824, 5403
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.