Rmu_sc0017105.1_g000011

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017105.1
Physical Location & Seq
Reverse (-)
33410 .. 40486
7077 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017105.1_g000011.1.cds

Sequence Viewer

Length: 3711 bp
ctgaaagatttagcacctggaaggcagaatgaacagtactcttggggccaagggagtcgactcataataacaactagggataggcgtccattgatagaatgtgaagtacataaaatatatgaggctgaaaaacttagtgatgaggaagcttctcagctcatatgtcaacaagccttcaagaaaaactatccaccagctgagtttgtagagctgtccaagagttttgtaaaatatgccggtggccttcctctagctcataaagttaagggttcacaattgtggggaagggaggtagatgaatggtcagaggtattagatagactggacgaagatctggataaagacatttttagtgtgcttgaaataagttttgatggattacaggatacagataagaaaatctttttggacatcgcatgtttcttcaatggtgaggatcatgttcgtgtacaaaagatattgaaaagttgtggtttttctcctcgaataggcataactaacctcattgacaaatctctgatcaaaattgaaagtgaaaaactgtggatgcatgaattactacggtgtttgggttggcatattgttcgcagagaatcaaaaccttttccgggtaaacgtagcagattgtggcttgatgataatgcacacaagtacaaaggcagaaggccatggcactttgaggatgctcgtaatgtactcgagagtaataccggaacatctgctgttgaaggcttattcttaagcttgggtgaaaaagaagaaatgcgtttgagcaatgacccattcttaactatgaccaaactaagattgctgaagatttataatgtaaattttctgggtgggcattttacatatctctctgacgatttacgttgtctggaatggcacgaatgtcctctaaagtctctgccatctggttttacgccctatcagctggttgaattcaagatgcctaacagctgcattgaacgactgtggaagaaaacgccttctatgagaatgctgacactcatggatctttccaactgccaatatctagtcacgacccctgacttcggtgaggtcccaaatcttgagagattgatccttgaaggttgtaaagagttatccgcggttcacccaacaattagggatctccagcatctgattttattgaatttgaaaggctgtgcaagtctaaagagccttcccccatcaatcagcttgagatctcttcaaacttttattctttcgggatgttcaaaactggagaagtttccggagattgtgggaaacatgcaaactttgtcagaactttatttagatggcaccgctataagggagctgcctgtatcaatccagcttttaacaggccttgttttgctaaatctatgtggctgcaagacccttccgagtcttccaagcgctctttgtagaagtttgacatcactgaaatttctttatctgtcatggtgctctagtttggacaaactgccagaaaacataggctccttggaacacttggaggagcttgatgcatgtcatactgctataagaaaagtgcccgagtccatttcactactcaagaatcttaaactactgtgtttccatggctgctctggatacacaggtctagagatgccaaacaagttctcaggtctaagatgtttgacaacactaaacctaggtggatgtaatctccctgaaggagcaatccccagtgacattggcaatttgttctcactgcagagtctggatttaagtgaaaacaactttttcaccatacctgaaagcatctctcaactttctgagcttacagaaatttttctgtttaggtgtagcaaactacaatcgttgccaaaagatcttccatcaagactaagaactataaatttacgggactgtcctatgctgacagattcttcatataatttgatgagatatccacctcgaaagggtttaagtactatcataagttgtcgaaaaccagaggaggatgagcagttgccaatattgctacctgaactcgatgaggtgtctctttctctgcagttgccaatgctacctgaactccatgagtttcatttgggaaatctggaaaaactcgatctttcctactgccaacacttgaagaagatccctgacttgaatggggttccaaaccttaagaaattgatccttgaaggctgtgaaaaattatcagaggttcacccaacatttgggagtctccaacatctgatttttttgaatatgaaaggatgtgtagatctagagagccttccccgcttcatctgcatgaaatatcttgaaatctgtattctttcaggatgttcaaagcttaaagagtttccggagattaatggagatatggataaattgtcacaactgcatttagatgggacggctttagagaatctgccgataccaatgcagcatttgaaatgccctattgtgataaatctaagaggttgcaagaacctattgactattccagtccttttgagtctgaaagctctcaatctgtcaggctgctctcgtatatccggatttccaaataacttgggaagcatggcacatttggaggagcttgatgcctctgaaactgctataacacgagtaccccagtccatttcatttatggagaagcttaaagtgttgtctttctatggatgtaaaggtttgcagttgcctaaccggttctcgcaattaagctttttgacatctttaaatctacggaggtgtggtctagcagaaataacagtccttgctagcctctgtggcttatcctcactgcaaaagttggatttgagtggaaacaaatttgtgagtatacctagtgaaattagtcacttatcctctttgaagcgattgaatttgagtaggaacgacttgatgagtgtaccagatgcaattggtggcttatcctctttgcaacaattgaatttgagtatgaacgacttggtgagtataccagatgcaattgatcgactttcctctctgcagcaattggatttgagtatgaacgacttggtgagtataccagatgcaattggtcgactctcctctctgcagcaattggatttgagtatgaacgacttggtgagtataccagatgcaattggtggcttatcctctttgcagcaattgaatttgagtacgaacgacttggtgagtataccagatgcaattggtcgactttcctctttgcagcaattggatttgagtatgaacgacttggtgagtataccagatgcaattggtggcttatcctctttgcagcgattggatttgagtatgaacgacttggtgagtataccagatgcaattggtggcttatcctctttgcagcgattggatttgagtacgaacgacttgatgagtataccagatgcaattggtcgactctcctctttgcagcgattggatttgagtacgaacgacttggtgagtataccagatgcaattggtcgactctcctctttgcagcgattggatttgagtatgaacgacttggtgagtataccagatgcaattggtggcttatcgtctttgcagcgattggatttgagtgcaaacgacttggtgagtataccagatgcaattggtcgactctcctcgttggagcgattggatttgagtaggaacaggctggtgagcataccagatgcaatcggtctcttaacatccttgaagcatttagattggagtgaaaacaactcagtgagtaactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1236

Amino Acids

137.63

Weight (kDa)

5.59

Isoelectric Point (pI)

43.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000307)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g16600 FvH4_1g16610 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16621 FvH4_1g16630 FvH4_1g16640 FvH4_1g16640 FvH4_1g16650 FvH4_1g16650 FvH4_3g27631 FvH4_4g11392 FvH4_4g11542
prunus_persica Prupe.4G224500_v2.0.a1 Prupe.4G226900_v2.0.a1 Prupe.4G227000_v2.0.a1
pyrus_communis pycom11g18180 pycom11g18210 pycom11g18230 pycom11g18270 pycom11g18350 pycom11g18360 pycom11g18370
rosa_chinensis RchiOBHm_Chr2g0106511 RchiOBHm_Chr2g0106541 RchiOBHm_Chr2g0106551 RchiOBHm_Chr2g0106571 RchiOBHm_Chr2g0124621 RchiOBHm_Chr6g0251591 RchiOBHm_Chr6g0251631 RchiOBHm_Chr6g0251641
rosa_laevigata RLG00000015443 RLG00000015444 RLG00000015458 RLG00000017510 RLG00000017511 RLG00000017512 RLG00000017515 RLG00000017516 RLG00000017517 RLG00000018809 RLG00000020934 RLG00000020935 RLG00000034092
rosa_multiflora Rmu_co8285777.1_g000001 Rmu_sc0000762.1_g000001 Rmu_sc0001872.1_g000006 Rmu_sc0005255.1_g000019 Rmu_sc0005597.1_g000006 Rmu_sc0012104.1_g000001 Rmu_sc0017105.1_g000011 Rmu_sc0022904.1_g000001 Rmu_ssc0000135.1_g000049 Rmu_ssc0000213.1_g000047
rosa_roxburghii Rroxscaffold_2G00092830 Rroxscaffold_2G00119790 Rroxscaffold_2G00137010 Rroxscaffold_2G00137030 Rroxscaffold_2G00137070 Rroxscaffold_7G00216560
rosa_rugosa Rorug02G0136100 Rorug02G0136200 Rorug02G0136300 Rorug02G0136400 Rorug02G0251800 Rorug02G0251800 Rorug02G0455500 Rorug02G0455600 Rorug02G0455700 Rorug05G0195300
rosa_samantha Rh2AG187400 Rh2AG187500 Rh2AG187600 Rh2AG310500 Rh2BG198200 Rh2BG198300 Rh2BG198400 Rh2BG198600 Rh2BG318900 Rh2BG534300 Rh2CG192400 Rh2CG192500 Rh2CG192600 Rh2CG297500 Rh2DG193500 Rh2DG193600 Rh2DG193800 Rh2DG334200 Rh2DG543100 Rh5AG280400 Rh5BG285800 Rh5BG285900 Rh5CG317900 Rh5CG318000 Rh5DG294600 Rh5DG294700 Rh6AG012200 Rh6AG012700 Rh6BG011200 Rh6BG011700
rosa_wichuraiana Rw0G009380 Rw2G014610 Rw2G014630 Rw2G014640 Rw2G014680 Rw2G025120 Rw2G043000 Rw5G026490 Rw6G001370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 822
AccB1I GGYRCC 1 cut(s) 1307
AccB7I CCANNNNNTGG 1 cut(s) 2198
AccII CGCG 1 cut(s) 1112
AccIII TCCGGA 3 cut(s) 1258, 2329, 2522
AciI CCGC 4 cut(s) 1110, 1112, 1311, 2263
AclWI GGATC 6 cut(s) 444, 1023, 1078, 1140, 2110, 2149
AcuI CTGAAG 2 cut(s) 833, 1704
AcyI GRCGYC 1 cut(s) 85
AfeI AGCGCT 1 cut(s) 1405
AfiI CCNNNNNNNGG 6 cut(s) 488, 608, 1055, 1317, 1934, 2198
AflII CTTAAG 2 cut(s) 739, 2144
AgeI ACCGGT 1 cut(s) 2673
AjnI CCWGG 1 cut(s) 16
AjuI GAANNNNNNNTTGG 2 cut(s) 389, 421
AleI CACNNNNGTG 1 cut(s) 277
Alw21I GWGCWC 1 cut(s) 1457
Alw26I GTCTC 4 cut(s) 909, 2022, 2210, 3659
AlwI GGATC 6 cut(s) 444, 1023, 1078, 1140, 2110, 2149
AlwNI CAGNNNCTG 2 cut(s) 1144, 1732
Ama87I CYCGRG 2 cut(s) 698, 1544
Aor13HI TCCGGA 3 cut(s) 1258, 2329, 2522
Aor51HI AGCGCT 1 cut(s) 1405
AoxI GGCC 4 cut(s) 46, 241, 665, 1351
AseI ATTAAT 1 cut(s) 2337
AsiGI ACCGGT 1 cut(s) 2673
Asp700I GAANNNNTTC 1 cut(s) 1803
AspA2I CCTAGG 1 cut(s) 1663
AspLEI GCGC 1 cut(s) 1406
AspS9I GGNCC 2 cut(s) 46, 1063
AsuC2I CCSGG 1 cut(s) 609
AsuNHI GCTAGC 1 cut(s) 2747
AvaI CYCGRG 2 cut(s) 698, 1544
AvaII GGWCC 1 cut(s) 1063
AvrII CCTAGG 1 cut(s) 1663
BaeGI GKGCMC 1 cut(s) 1545
BaeI ACNNNNGTAYC 4 cut(s) 1594, 1627, 2580, 2613
BanI GGYRCC 1 cut(s) 1307
BauI CACGAG 1 cut(s) 2592
BbsI GAAGAC 1 cut(s) 1388
Bbv12I GWGCWC 1 cut(s) 1457
BccI CCATC 6 cut(s) 368, 919, 1201, 1298, 1858, 2369
BceAI ACGGC 1 cut(s) 2397
BcgI CGANNNNNNTGC 4 cut(s) 566, 600, 2389, 2423
BciT130I CCWGG 1 cut(s) 18
BciVI GTATCC 2 cut(s) 379, 1595
BclI TGATCA 1 cut(s) 519
BcnI CCSGG 1 cut(s) 609
BcoDI GTCTC 4 cut(s) 909, 2022, 2210, 3659
BfmI CTRYAG 4 cut(s) 1724, 2027, 2978, 3047
BfoI RGCGCY 1 cut(s) 1407
BfrI CTTAAG 2 cut(s) 739, 2144
BfuI GTATCC 2 cut(s) 379, 1595
BglI GCCNNNNNGGC 1 cut(s) 2757
BglII AGATCT 4 cut(s) 331, 1208, 1843, 2245
BlnI CCTAGG 1 cut(s) 1663
BmcAI AGTACT 2 cut(s) 38, 1945
Bme1390I CCNGG 2 cut(s) 18, 609
Bme18I GGWCC 1 cut(s) 1063
BmeT110I CYCGRG 2 cut(s) 698, 1544
BmgT120I GGNCC 2 cut(s) 46, 1063
BmiI GGNNCC 5 cut(s) 47, 1065, 1309, 1489, 2136
BmrFI CCNGG 2 cut(s) 18, 609
BmrI ACTGGG 2 cut(s) 1692, 2596
BmtI GCTAGC 1 cut(s) 2751
BmuI ACTGGG 2 cut(s) 1692, 2596
BpiI GAAGAC 1 cut(s) 1388
BpmI CTGGAG 2 cut(s) 1121, 1268
BpuEI CTTGAG 3 cut(s) 1094, 1225, 1547
BpuMI CCSGG 1 cut(s) 609
BsaHI GRCGYC 1 cut(s) 85
BsaI GGTCTC 1 cut(s) 3659
BsaJI CCNNGG 6 cut(s) 49, 668, 1110, 1491, 1588, 1663
BsaWI WCCGGW 5 cut(s) 710, 1258, 2329, 2522, 2673
BsaXI ACNNNNNCTCC 6 cut(s) 1472, 1502, 2034, 2064, 2707, 2737
Bsc4I CCNNNNNNNGG 6 cut(s) 488, 608, 1055, 1317, 1934, 2198
Bse118I RCCGGY 2 cut(s) 236, 2673
Bse1I ACTGG 5 cut(s) 327, 1251, 1698, 2471, 2602
Bse3DI GCAATG 1 cut(s) 781
BseAI TCCGGA 3 cut(s) 1258, 2329, 2522
BseBI CCWGG 1 cut(s) 18
BseDI CCNNGG 6 cut(s) 49, 668, 1110, 1491, 1588, 1663
BseGI GGATG 9 cut(s) 552, 688, 1241, 1676, 1981, 2243, 2312, 2654, 3662
BseLI CCNNNNNNNGG 6 cut(s) 488, 608, 1055, 1317, 1934, 2198
BseMI GCAATG 1 cut(s) 781
BseMII CTCAG 5 cut(s) 167, 189, 1647, 1779, 3711
BseNI ACTGG 5 cut(s) 327, 1251, 1698, 2471, 2602
BseRI GAGGAG 8 cut(s) 471, 1520, 1985, 2576, 3031, 3376, 3445, 3583
BseSI GKGCMC 1 cut(s) 1545
Bsh1236I CGCG 1 cut(s) 1112
BshFI GGCC 4 cut(s) 48, 243, 667, 1353
BshNI GGYRCC 1 cut(s) 1307
BshTI ACCGGT 1 cut(s) 2673
BsiHKAI GWGCWC 1 cut(s) 1457
BsiHKCI CYCGRG 2 cut(s) 698, 1544
BsiSI CCGG 7 cut(s) 237, 608, 711, 1259, 2330, 2523, 2674
BslFI GGGAC 3 cut(s) 1049, 1892, 2392
BslI CCNNNNNNNGG 6 cut(s) 488, 608, 1055, 1317, 1934, 2198
BsmAI GTCTC 4 cut(s) 909, 2022, 2210, 3659
BsmFI GGGAC 3 cut(s) 1049, 1892, 2392
BsmI GAATGC 1 cut(s) 1005
BsnI GGCC 4 cut(s) 48, 243, 667, 1353
Bso31I GGTCTC 1 cut(s) 3659
BsoBI CYCGRG 2 cut(s) 698, 1544
Bsp1286I GDGCHC 2 cut(s) 1457, 1545
Bsp13I TCCGGA 3 cut(s) 1258, 2329, 2522
Bsp1407I TGTACA 1 cut(s) 448
Bsp19I CCATGG 2 cut(s) 668, 1588
BspACI CCGC 4 cut(s) 1110, 1112, 1311, 2263
BspANI GGCC 4 cut(s) 48, 243, 667, 1353
BspCNI CTCAG 5 cut(s) 166, 190, 1646, 1780, 3710
BspEI TCCGGA 3 cut(s) 1258, 2329, 2522
BspFNI CGCG 1 cut(s) 1112
BspLI GGNNCC 5 cut(s) 47, 1065, 1309, 1489, 2136
BspMAI CTGCAG 4 cut(s) 1728, 2031, 2982, 3051
BspOI GCTAGC 1 cut(s) 2751
BspPI GGATC 6 cut(s) 444, 1023, 1078, 1140, 2110, 2149
BspT107I GGYRCC 1 cut(s) 1307
BspTI CTTAAG 2 cut(s) 739, 2144
BspTNI GGTCTC 1 cut(s) 3659
BsrDI GCAATG 1 cut(s) 781
BsrFI RCCGGY 2 cut(s) 236, 2673
BsrGI TGTACA 1 cut(s) 448
BsrI ACTGG 5 cut(s) 327, 1251, 1698, 2471, 2602
BssAI RCCGGY 2 cut(s) 236, 2673
BssECI CCNNGG 6 cut(s) 49, 668, 1110, 1491, 1588, 1663
BssNI GRCGYC 1 cut(s) 85
BssSI CACGAG 1 cut(s) 2592
BssT1I CCWWGG 5 cut(s) 49, 668, 1491, 1588, 1663
Bst2BI CACGAG 1 cut(s) 2592
Bst2UI CCWGG 1 cut(s) 18
Bst4CI ACNGT 7 cut(s) 36, 543, 564, 975, 1581, 1883, 2740
Bst6I CTCTTC 1 cut(s) 1218
BstACI GRCGYC 1 cut(s) 85
BstAFI CTTAAG 2 cut(s) 739, 2144
BstAUI TGTACA 1 cut(s) 448
BstC8I GCNNGC 1 cut(s) 2749
BstDSI CCRYGG 3 cut(s) 668, 1110, 1588
BstENI CCTNNNNNAGG 1 cut(s) 486
BstF5I GGATG 9 cut(s) 552, 688, 1241, 1676, 1981, 2243, 2312, 2654, 3662
BstFNI CGCG 1 cut(s) 1112
BstH2I RGCGCY 1 cut(s) 1407
BstHHI GCGC 1 cut(s) 1406
BstMAI GTCTC 4 cut(s) 909, 2022, 2210, 3659
BstMWI GCNNNNNNNGC 5 cut(s) 931, 1993, 2262, 2271, 2757
BstNI CCWGG 1 cut(s) 18
BstNSI RCATGY 3 cut(s) 420, 1279, 1521
BstSCI CCNGG 2 cut(s) 16, 607
BstSFI CTRYAG 4 cut(s) 1724, 2027, 2978, 3047
BstSLI GKGCMC 1 cut(s) 1545
BstUI CGCG 1 cut(s) 1112
BstV2I GAAGAC 1 cut(s) 1388
BstX2I RGATCY 7 cut(s) 331, 1015, 1132, 1208, 1843, 2115, 2245
BstYI RGATCY 7 cut(s) 331, 1015, 1132, 1208, 1843, 2115, 2245
BsuI GTATCC 2 cut(s) 379, 1595
BsuRI GGCC 4 cut(s) 48, 243, 667, 1353
BtgI CCRYGG 3 cut(s) 668, 1110, 1588
BtgZI GCGATG 1 cut(s) 397
BtsCI GGATG 9 cut(s) 552, 688, 1241, 1676, 1981, 2243, 2312, 2654, 3662
BtsI GCAGTG 2 cut(s) 1721, 2768
BtsIMutI CAGTG 5 cut(s) 1427, 1705, 1721, 2768, 3705
Cac8I GCNNGC 1 cut(s) 2749
CaiI CAGNNNCTG 2 cut(s) 1144, 1732
CfoI GCGC 1 cut(s) 1406
Cfr10I RCCGGY 2 cut(s) 236, 2673
Cfr13I GGNCC 2 cut(s) 46, 1063
Cfr42I CCGCGG 1 cut(s) 1113
CseI GACGC 1 cut(s) 74
CspAI ACCGGT 1 cut(s) 2673
DraI TTTAAA 1 cut(s) 2706
Eam1104I CTCTTC 1 cut(s) 1218
EarI CTCTTC 1 cut(s) 1218
Eco130I CCWWGG 5 cut(s) 49, 668, 1491, 1588, 1663
Eco147I AGGCCT 1 cut(s) 1353
Eco31I GGTCTC 1 cut(s) 3659
Eco32I GATATC 1 cut(s) 1922
Eco47I GGWCC 1 cut(s) 1063
Eco47III AGCGCT 1 cut(s) 1405
Eco57I CTGAAG 2 cut(s) 833, 1704
Eco88I CYCGRG 2 cut(s) 698, 1544
EcoNI CCTNNNNNAGG 1 cut(s) 486
EcoO109I RGGNCCY 1 cut(s) 1063
EcoRI GAATTC 1 cut(s) 941
EcoRII CCWGG 1 cut(s) 16
EcoRV GATATC 1 cut(s) 1922
EcoT14I CCWWGG 5 cut(s) 49, 668, 1491, 1588, 1663
EcoT22I ATGCAT 2 cut(s) 552, 1519
ErhI CCWWGG 5 cut(s) 49, 668, 1491, 1588, 1663
FalI AAGNNNNNCTT 2 cut(s) 386, 418
FaqI GGGAC 3 cut(s) 1049, 1892, 2392
FauI CCCGC 1 cut(s) 2270
FauNDI CATATG 1 cut(s) 161
FbaI TGATCA 1 cut(s) 519
FokI GGATG 9 cut(s) 559, 695, 1248, 1683, 1988, 2250, 2319, 2661, 3649
GlaI GCGC 1 cut(s) 1405
GsuI CTGGAG 2 cut(s) 1121, 1268
HaeII RGCGCY 1 cut(s) 1407
HaeIII GGCC 4 cut(s) 48, 243, 667, 1353
HapII CCGG 7 cut(s) 237, 608, 711, 1259, 2330, 2523, 2674
HgaI GACGC 1 cut(s) 74
HhaI GCGC 1 cut(s) 1406
Hin1I GRCGYC 1 cut(s) 85
Hin6I GCGC 1 cut(s) 1404
HinP1I GCGC 1 cut(s) 1404
HincII GTYRAC 7 cut(s) 59, 167, 3035, 3173, 3380, 3449, 3587
HindII GTYRAC 7 cut(s) 59, 167, 3035, 3173, 3380, 3449, 3587
HindIII AAGCTT 5 cut(s) 147, 742, 2315, 2624, 2689
HpaII CCGG 7 cut(s) 237, 608, 711, 1259, 2330, 2523, 2674
HpyCH4III ACNGT 7 cut(s) 36, 543, 564, 975, 1581, 1883, 2740
HpyCH4IV ACGT 2 cut(s) 616, 871
HpyF10VI GCNNNNNNNGC 5 cut(s) 931, 1993, 2262, 2271, 2757
HpySE526I ACGT 2 cut(s) 616, 871
Hsp92I GRCGYC 1 cut(s) 85
HspAI GCGC 1 cut(s) 1404
Kpn2I TCCGGA 3 cut(s) 1258, 2329, 2522
Ksp22I TGATCA 1 cut(s) 519
KspI CCGCGG 1 cut(s) 1113
LmnI GCTCC 6 cut(s) 1321, 1493, 1507, 1688, 2563, 3601
MaeII ACGT 2 cut(s) 616, 871
MaeIII GTNAC 5 cut(s) 1039, 1700, 2358, 2825, 3704
MflI RGATCY 7 cut(s) 331, 1015, 1132, 1208, 1843, 2115, 2245
MhlI GDGCHC 2 cut(s) 1457, 1545
MmeI TCCRAC 4 cut(s) 1047, 2233, 2760, 3579
Mph1103I ATGCAT 2 cut(s) 552, 1519
MroI TCCGGA 3 cut(s) 1258, 2329, 2522
MroXI GAANNNNTTC 1 cut(s) 1803
MslI CAYNNNNRTG 4 cut(s) 277, 444, 2273, 2373
MspA1I CMGCKG 4 cut(s) 197, 934, 960, 1112
MspCI CTTAAG 2 cut(s) 739, 2144
MspI CCGG 7 cut(s) 237, 608, 711, 1259, 2330, 2523, 2674
MspR9I CCNGG 2 cut(s) 18, 609
Mva1269I GAATGC 1 cut(s) 1005
MvaI CCWGG 1 cut(s) 18
MvnI CGCG 1 cut(s) 1112
MwoI GCNNNNNNNGC 5 cut(s) 931, 1993, 2262, 2271, 2757
NciI CCSGG 1 cut(s) 609
NcoI CCATGG 2 cut(s) 668, 1588
NdeI CATATG 1 cut(s) 161
NheI GCTAGC 1 cut(s) 2747
NlaIV GGNNCC 5 cut(s) 47, 1065, 1309, 1489, 2136
NmuCI GTSAC 4 cut(s) 1039, 1700, 2358, 2825
NsiI ATGCAT 2 cut(s) 552, 1519
NspI RCATGY 3 cut(s) 420, 1279, 1521
OliI CACNNNNGTG 1 cut(s) 277
PaeR7I CTCGAG 1 cut(s) 698
PceI AGGCCT 1 cut(s) 1353
PctI GAATGC 1 cut(s) 1005
PdmI GAANNNNTTC 1 cut(s) 1803
PfeI GAWTC 4 cut(s) 593, 1567, 1898, 2392
PflMI CCANNNNNTGG 1 cut(s) 2198
PinAI ACCGGT 1 cut(s) 2673
PpuMI RGGWCCY 1 cut(s) 1063
PshBI ATTAAT 1 cut(s) 2337
PsiI TTATAA 1 cut(s) 822
Psp5II RGGWCCY 1 cut(s) 1063
Psp6I CCWGG 1 cut(s) 16
PspGI CCWGG 1 cut(s) 16
PspN4I GGNNCC 5 cut(s) 47, 1065, 1309, 1489, 2136
PspPI GGNCC 2 cut(s) 46, 1063
PspPPI RGGWCCY 1 cut(s) 1063
PstI CTGCAG 4 cut(s) 1728, 2031, 2982, 3051
PstNI CAGNNNCTG 2 cut(s) 1144, 1732
PsuI RGATCY 7 cut(s) 331, 1015, 1132, 1208, 1843, 2115, 2245
PvuII CAGCTG 3 cut(s) 197, 934, 960
RseI CAYNNNNRTG 4 cut(s) 277, 444, 2273, 2373
SacII CCGCGG 1 cut(s) 1113
SalI GTCGAC 6 cut(s) 57, 3033, 3171, 3378, 3447, 3585
Sau96I GGNCC 2 cut(s) 46, 1063
ScaI AGTACT 2 cut(s) 38, 1945
ScrFI CCNGG 2 cut(s) 18, 609
SduI GDGCHC 2 cut(s) 1457, 1545
SfcI CTRYAG 4 cut(s) 1724, 2027, 2978, 3047
Sfr274I CTCGAG 1 cut(s) 698
Sfr303I CCGCGG 1 cut(s) 1113
SgrBI CCGCGG 1 cut(s) 1113
SinI GGWCC 1 cut(s) 1063
SlaI CTCGAG 1 cut(s) 698
SmiMI CAYNNNNRTG 4 cut(s) 277, 444, 2273, 2373
SmlI CTYRAG 6 cut(s) 698, 739, 1073, 1204, 1562, 2144
SmoI CTYRAG 6 cut(s) 698, 739, 1073, 1204, 1562, 2144
SseBI AGGCCT 1 cut(s) 1353
SsiI CCGC 4 cut(s) 1110, 1112, 1311, 2263
SspI AATATT 1 cut(s) 1992
StuI AGGCCT 1 cut(s) 1353
StyD4I CCNGG 2 cut(s) 16, 607
StyI CCWWGG 5 cut(s) 49, 668, 1491, 1588, 1663
TaaI ACNGT 7 cut(s) 36, 543, 564, 975, 1581, 1883, 2740
TaiI ACGT 2 cut(s) 619, 874
TaqII GACCGA 1 cut(s) 3641
TatI WGTACW 6 cut(s) 36, 106, 448, 651, 694, 1943
TfiI GAWTC 4 cut(s) 593, 1567, 1898, 2392
TscAI CASTG 5 cut(s) 1434, 1705, 1728, 2775, 3705
TseFI GTSAC 4 cut(s) 1039, 1700, 2358, 2825
Tsp45I GTSAC 4 cut(s) 1039, 1700, 2358, 2825
TspGWI ACGGA 1 cut(s) 2728
TspRI CASTG 5 cut(s) 1434, 1705, 1728, 2775, 3705
Van91I CCANNNNNTGG 1 cut(s) 2198
Vha464I CTTAAG 2 cut(s) 739, 2144
VpaK11BI GGWCC 1 cut(s) 1063
VspI ATTAAT 1 cut(s) 2337
XagI CCTNNNNNAGG 1 cut(s) 486
XbaI TCTAGA 2 cut(s) 1612, 2248
XceI RCATGY 3 cut(s) 420, 1279, 1521
XcmI CCANNNNNNNNNTGG 2 cut(s) 1595, 2614
XhoI CTCGAG 1 cut(s) 698
XmaJI CCTAGG 1 cut(s) 1663
XmnI GAANNNNTTC 1 cut(s) 1803
ZrmI AGTACT 2 cut(s) 38, 1945
Zsp2I ATGCAT 2 cut(s) 552, 1519
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.