Rmu_ssc0000213.1_g000047

resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000213.1
OG0000307
Physical Location & Seq
Reverse (-)
176507 .. 186962
10456 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000213.1_g000047.1.cds

Sequence Viewer

Length: 7038 bp
atggaacatgagaaagttccagcagtagcttcctcttctttgggctcaacattggaacatggtgtcgtatcccatgatgtcttcctcagctttagaggtgaagacacccgctatgcttttactgaccatttatatagtgctatgaagcggcaaggaatagatgcattcagagatgcagaaaaactcgagaggggacatccaatttcatccgatctcttgaaagcaatagcagaatcccgaattgcagtcgtcattctttcagctaactatgctgattcaacatggtgtttggaggagcttgcacagattgttaaatgcaaaaagttgacggggttgaaagttttaccagtcttctatcacgtcgaaccatcagaagtaaggaagcaaacaggaaaatttaacgaggcgttttgcaagcataaagaaactttcaaagacaagaacccgtgtccgctatcttttcctctcgctctgggtttcctctcttctctcgtgagagtcggtggcgatatcttccgccctccatgggcgcttttgctcaggcgatggcctgtttatgaggcttcttgccttcgtttttcaattctgtttcttaatttcgtgtttccctttcgctttggtccgttctcatcgactccggtatttccctttcccgatcaaaatttcgattacctctcagatccaatttcttgtttgggtgttgctgtttccagtgactctcctccgatgccttcagtcgccgttttaaacgggctttgcccgttatcgcacatgggttggatcccaattgtgcaacacaggattgttcatccttcgggtggctgtccagttgatccctgtgtggatctgtttacttttcgtcctgctttggcttttctggcttctactttggcgatggaagatgttctccgtttcggagatgatatgagatttgtgacttcttgtgggtctggaatcgggatattccggtgctctcgtttgagttcgttgttggcttttttcaagcttttcgactctggcctgatggtgttcttcatacttggtgcgaattttgttcgtggtggcgctaccgctgtggcagcgtccttctctttgccggattggggtttgggtggcctagactcgcctggtttgagtctaggagaatcagaagttattcaggaaataactacaaagatattgaacatgttgtataacatgtgctcaagtgataacttggattttattggaattgatgctcgtatagagaaactaatgtcttacttggatctggggtcgaatgatgttcgcaccatagggatttccgggatgggcggcatcggtaaatcaactctggcaaaggcagtttttgaaaagatccgtatccaatttgaatctgctagctgctttattagtattgctgatgaaaaagggaaatccccaactgaattgcagaaacttctctgtcaaaatttgaagctggacagccatacaagtatacagaatgatcttatgggggtccagttattaaggaaaagattacttcatcaaaaggtgctcatcattctagacggtgttgatcatgttaaacaactaaaagatgttatcgatagtcatgagccttgtttgggtccagggagcagagtcattataacaactagagatacgcacattctgaaggaatttggattgctgggagggaacatatatgaggttgagaaattgactgataaggaatctcttcagctcttatgtcagaaagctttcacgaaaaaccaccctccagatgaatataaggaactatccaatagttttgtaaaatattgcagtggccttcctttagctctcgaagttctgggttctaagttgtgtaagagaacggttgatgaatggtcagcagcattggctagacttgataaagatactgacaaaggtatttttcctgttcttcaattaagttatgatggattagaagaaacagagaaggaaatctttttggacatagcatgtttcttcagaggcgagagtcaatatcatgtaaaaccgattttagaagcttgtggcttctttcctgatatcggaatacccgtcctcgttgaaaaatatttaattaaacttgagaaagataaactgtggatgcatgatttactacagcaaatgggttggcatattgttcgggacgcagctgcaggtgagctgggaaaacgaagtaggttgtggcttaatgagaattccgatgagtatgaacacggcagcctgtggtttgatgaggacactcatgatgtaatcaccgagaatttgggaacaattgctgtccaaggtatatatttgagcgtgctggctaagaaagtgataccattgcaagctgatcccttcttaaatatgcgcaagctaagattgttgaagatttgtaatgtcaacttgatggatgtgcgatttgaatatctgtccaacaagttacgacttttggaatggcacgaatgtcctctacaatctctgccatccagttttcaaccagataatcttgtcgaattgaaactgcccaagagccgcattgaaacactgtggactcgaagtctctgtctggagaagctaatatggatggatctttcgtactgccaatacttggtcaagaccccggacttcagtaatttcccaaatcttggagagttgacttttgaaggttgtagaaaattatcagatgttcacccaacactttggagactcaaaaatttgaaggctttaagttttaaagattgcacgagtctagagaggcttcccaagtccatcagcttgcaatctcttgcagttctcattctttccggatgttcaaaactagatgagtttccagagatactgggaaacgggaaaaacctgttagtactctctttgaataaaacagctataagagagctgccgacaacaatcgggtgcttaagtggcctaattaatttaagtgtatgtgcctgcaagaacttggtgggtcttccaagcttcatttgcagtttgaagtctctgagacgtctgcttctgtcatattcctcacgcattgaccaacttccagaagacatagggagcttggaaaatttggaggaccttgatgcttgtagcactgctataagaaaagtgccttcgtccattgtacttctgaagaatctgaaatcattatgtttccaggcatgtaggcaggtgcccgggaaatgctctgatgaatccttgggtttgcaattgccaaagtcgttctccggtttgagctcactggaaacactatatttaggtcaatgcgatcttgctgaaggagcgatccctgatgacattggctgcttatcctcactgaagcatttaaggttggatgaaaacaattttgtgagtatacctgaaagcatctctcaacttccaaaccttagagaactttacatcaaagattgtagcaagcttcagtctttgccaaaacgtcttccaaaggatgttactgtagaggctagtggatgtcccctgctgaccaactatccaaaccagcttaacgtatggctttctgatgatgggatccatagcataaattgtggaaattcagagcatgcaaggtgttcacttccaattcccgaagaacaaattgaagaatacttacccaagttctttgaggatgaaattgttcgtcagcagcacttacacacgttttccttcaatacaagaattcctgattggtgtcgtcataagagtagagagtcttcaaagaattctgtagccatgcaagtgtctgatcttgagcttaacaagagcttaggagtagccttgtttgttgtttttgaaatctttgagagtggtcacgattttgatgagagttggaagttgcaacggagcatttgtacttttaaagatgaccaaggacaagaaaaacataaagaaatccttcaaacctgtgcaaacttccgggctgggacacatgtattatgttactatgagccgatgaagtacttacatgctgctggaatgttgttgagagcaagtcgatttgaggctttaatttcaacagagagaccggatctggagattaagtcttgtgggatgcaactaatctttcagggagaagctagagagttcgctcaaaaattaagtaaggcttttaatcctcagacggatttcaaatttggtagacattgtaagaaattgataaacgccaagggaaaggaaagctccggtaatataatggcaccaaatgaagcagaaaaggtcagctggaaatttgattctaacattcatccgggagaggatttcaatcgggacatatataatgctcattgcgctaaacttttggagtggttcggtgatcatcatctcggtaggagcccttcagtgaagatcctgttaccaccatctctatctagtgatgggaattggataggattggctctatgtgcacgtttttcaggcctcgagaatcagactacctccatagacaaagtgaatccagaaattgctgagcttgtttgtcatttggaaaatcagaacagtggtttcaaacatattcaccggtatcgaccaaccaatgaagaactcaagcggttatgtcctgcagaattcatttggctatcttatataccacgtcaggggtttctagatcagttaaatgagtgtgacctcttggaggtttcatttgccagcgaaagccgaggactgtctgctgaagaatgtggtctccgtcttgtctacaagcatgatgagcaagagtttaaggatctgtgtatcttcatggactcgttcctggacaaaagatctgaaaggttggaagaatatgaggctcccaagaagggtaaacacgttctagaatctgatttcaacctgcagccgagagaatacctacggttgttgctctcagtgctctatgagggaccatatggacgtgaaaaggactttggccttttttttccgcataaggtagttcctttctggttcttccatcactatgcaggggacgtagcactgtgcgactttcctctagacttatctgatgatcagagatggatcggtttagaactatttgttatggttacgagttgttacagtatcaatgttgaatccttacttgacgttgatttgtgttccgacgaaattagcacagtaagcacatctgtaatgataaacacttgtctggggtcagatcaacttgttgtaatccatataccacgcgtgcgttttccggagcagttgaatcgatgtcacgggatcagcgcattgtttagaaccgctactccagatatgagggttcgaatgtgtggaagccggttactatacgaacaaaatttggaagacttgatccgtgcaataactgtgtacacattagacagtcaagatgtcattgattcactttgtcagcacatccaacaattacttggaagttacttgccggaagaaccatctgatcatgtagcagcagttgaaaccgctgagcagaattcagtggaaggagaaaacgaggttggtcgcagtaatgatcattcctccactgaaagaggggacttgattcaagaacggagagagaaaatcttcacttcaatattgcacaactacagatcctatctccaacaaaagcatggttgtatagagtcgaaaagaattatatcccattctgaaggctatcttttggacaagggagatccaaagccggtgtttgccacgcatcatttgcatgtaatggttgagactcgactctatgggagctttagctcagaagattggaaacgatctctcgagtcattgcttcaatatttcaaggtggccactctcagtgtcaaaggtcaaatgattgctgttttaaatccattcactgcttcctcagtacacaatatctgcttccctcgaaaggaacttttaggatggttcacggaacagacgacaatgcccaggattcgattgaccatacccccacatgtatgtgatgatgagaattggatgggacttgctatatgtgctaccttttcagtccacgagcatccaagtgttgtccttgacaatctggccacaaggactttcaacgttatgtgtcatttgtcagcgttggatggacgatgtttcagtcactccccggtgtttaccataacaaaagagaaattcaagtggctacatcttcgtggatttatgtggtttacctacatacctcgttcttatcttacagagttcagagaagtaggtgttgcagaagctagaatttataatgattgcccaggattaatgatgaaagagtggagtatccgtcccttgttcaagcaagatgtgaaagaatttaataaagcaataatccactgctggacttcgttcttcgacaatttggatctcatccgtcagtctgtggaagcagatgaaaatgaacaggcacattattttgatagaggggaaaccagtaaaatcttgatgcctaaaggacatgtgaaggatttcaatcgggacatcatatatgatgcaacttaccctccttccgctaaacttttggagtggttcggtgatcatcatctcagtaggggcccttcagtcaaaatcccgttaccagcatctctatctactgatgggaattggataggattggctctatgtgcacgtttttcatacctcgagaatcaaactacctccatagacaaagtgaatccacaagttgaccttctttgtcatttggaaactgagaacagtggtttcgaacatcttcaccactatcgaccaaccaatgaagaattcaagcggttatgtcctacagaattcatttggctatcttatataccacgtcaggggtatctagatcagttaaatgagtgtgacctcttggaggcttcatttgctggcgaaagccgagggttgtttgctgaagtgtgtgttctccgtcttgtctaccagcatgatgagcaagagtttaaggatctgtgtaccttcatgaactcgttgctggacaaaatgggtaaacaagttctagaataccctgaacctgagattgaatggagacctaatgcaatgtggaatctggagatctacgacgatcgaaatgatttgcctcaggcgcacctcaaggcgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_3 LRR_8 NB-ARC TIR

Protein Analysis

2345

Amino Acids

266.17

Weight (kDa)

5.75

Isoelectric Point (pI)

42.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000307)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g16600 FvH4_1g16610 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16620 FvH4_1g16621 FvH4_1g16630 FvH4_1g16640 FvH4_1g16640 FvH4_1g16650 FvH4_1g16650 FvH4_3g27631 FvH4_4g11392 FvH4_4g11542
prunus_persica Prupe.4G224500_v2.0.a1 Prupe.4G226900_v2.0.a1 Prupe.4G227000_v2.0.a1
pyrus_communis pycom11g18180 pycom11g18210 pycom11g18230 pycom11g18270 pycom11g18350 pycom11g18360 pycom11g18370
rosa_chinensis RchiOBHm_Chr2g0106511 RchiOBHm_Chr2g0106541 RchiOBHm_Chr2g0106551 RchiOBHm_Chr2g0106571 RchiOBHm_Chr2g0124621 RchiOBHm_Chr6g0251591 RchiOBHm_Chr6g0251631 RchiOBHm_Chr6g0251641
rosa_laevigata RLG00000015443 RLG00000015444 RLG00000015458 RLG00000017510 RLG00000017511 RLG00000017512 RLG00000017515 RLG00000017516 RLG00000017517 RLG00000018809 RLG00000020934 RLG00000020935 RLG00000034092
rosa_multiflora Rmu_co8285777.1_g000001 Rmu_sc0000762.1_g000001 Rmu_sc0001872.1_g000006 Rmu_sc0005255.1_g000019 Rmu_sc0005597.1_g000006 Rmu_sc0012104.1_g000001 Rmu_sc0017105.1_g000011 Rmu_sc0022904.1_g000001 Rmu_ssc0000135.1_g000049 Rmu_ssc0000213.1_g000047
rosa_roxburghii Rroxscaffold_2G00092830 Rroxscaffold_2G00119790 Rroxscaffold_2G00137010 Rroxscaffold_2G00137030 Rroxscaffold_2G00137070 Rroxscaffold_7G00216560
rosa_rugosa Rorug02G0136100 Rorug02G0136200 Rorug02G0136300 Rorug02G0136400 Rorug02G0251800 Rorug02G0251800 Rorug02G0455500 Rorug02G0455600 Rorug02G0455700 Rorug05G0195300
rosa_samantha Rh2AG187400 Rh2AG187500 Rh2AG187600 Rh2AG310500 Rh2BG198200 Rh2BG198300 Rh2BG198400 Rh2BG198600 Rh2BG318900 Rh2BG534300 Rh2CG192400 Rh2CG192500 Rh2CG192600 Rh2CG297500 Rh2DG193500 Rh2DG193600 Rh2DG193800 Rh2DG334200 Rh2DG543100 Rh5AG280400 Rh5BG285800 Rh5BG285900 Rh5CG317900 Rh5CG318000 Rh5DG294600 Rh5DG294700 Rh6AG012200 Rh6AG012700 Rh6BG011200 Rh6BG011700
rosa_wichuraiana Rw0G009380 Rw2G014610 Rw2G014630 Rw2G014640 Rw2G014680 Rw2G025120 Rw2G043000 Rw5G026490 Rw6G001370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 1631, 6189
AarI CACCTGC 2 cut(s) 2159, 3157
AatII GACGTC 1 cut(s) 3004
Acc16I TGCGCA 1 cut(s) 2366
Acc36I ACCTGC 3 cut(s) 2159, 3157, 4827
AccB1I GGYRCC 2 cut(s) 3169, 4189
AccB7I CCANNNNNTGG 2 cut(s) 2605, 2642
AccI GTMKAC 5 cut(s) 1477, 3352, 4132, 4686, 6855
AccII CGCG 1 cut(s) 5166
AccIII TCCGGA 2 cut(s) 2801, 5176
AclI AACGTT 1 cut(s) 6012
AcoI YGGCCR 2 cut(s) 5754, 5994
AcyI GRCGYC 1 cut(s) 3001
AfaI GTAC 8 cut(s) 2594, 2862, 3123, 3847, 3953, 5312, 5817, 6892
AflII CTTAAG 1 cut(s) 2914
AflIII ACRYGT 8 cut(s) 1185, 1197, 3651, 3922, 4795, 5164, 5905, 6400
AgeI ACCGGT 1 cut(s) 4509
AhdI GACNNNNNGTC 1 cut(s) 2553
AjiI CACGTC 4 cut(s) 361, 4583, 4880, 6752
AjnI CCWGG 6 cut(s) 1126, 1612, 3153, 4740, 5879, 6199
AjuI GAANNNNNNNTTGG 8 cut(s) 3664, 3696, 4875, 4907, 5439, 5471, 6686, 6718
AloI GAACNNNNNNTCC 2 cut(s) 5212, 5244
Alw21I GWGCWC 7 cut(s) 974, 1205, 1539, 3236, 4399, 4860, 6571
Alw26I GTCTC 8 cut(s) 2561, 2695, 2992, 2997, 4009, 4679, 5672, 6958
Alw44I GTGCAC 2 cut(s) 4395, 6567
Ama87I CYCGRG 5 cut(s) 185, 3173, 4412, 5726, 6584
Aor13HI TCCGGA 2 cut(s) 2801, 5176
ApaI GGGCCC 1 cut(s) 6500
ApaLI GTGCAC 2 cut(s) 4395, 6567
ArsI GACNNNNNNTTYG 2 cut(s) 2545, 2577
AseI ATTAAT 2 cut(s) 2928, 6206
AsiGI ACCGGT 1 cut(s) 4509
Asp700I GAANNNNTTC 9 cut(s) 903, 1155, 1719, 1742, 3630, 3888, 5522, 6410, 6672
AspLEI GCGC 6 cut(s) 532, 1067, 2367, 4283, 5210, 7024
AspS9I GGNCC 7 cut(s) 620, 1498, 1610, 3073, 4868, 6496, 6497
AsuC2I CCSGG 7 cut(s) 1306, 2618, 3174, 3175, 3911, 4242, 6062
AsuHPI GGTGA 8 cut(s) 110, 2183, 2260, 2678, 4316, 4499, 6488, 6668
AsuII TTCGAA 2 cut(s) 5245, 6666
AsuNHI GCTAGC 1 cut(s) 1379
AvaI CYCGRG 5 cut(s) 185, 3173, 4412, 5726, 6584
AvaII GGWCC 5 cut(s) 620, 1498, 1610, 3073, 4868
AxyI CCTNAGG 1 cut(s) 7017
BaeGI GKGCMC 4 cut(s) 3174, 4399, 6500, 6571
BalI TGGCCA 2 cut(s) 5756, 5996
BamHI GGATCC 2 cut(s) 780, 3525
BanI GGYRCC 2 cut(s) 3169, 4189
BanII GRGCYC 4 cut(s) 47, 3236, 4328, 6500
BarI GAAGNNNNNNTAC 8 cut(s) 3588, 3620, 3691, 3723, 4312, 4344, 6484, 6516
BauI CACGAG 3 cut(s) 491, 2740, 5963
BbsI GAAGAC 8 cut(s) 73, 108, 343, 2957, 3051, 3428, 3699, 5292
Bbv12I GWGCWC 7 cut(s) 974, 1205, 1539, 3236, 4399, 4860, 6571
BbvCI CCTCAGC 1 cut(s) 86
BceAI ACGGC 2 cut(s) 725, 2245
BcgI CGANNNNNNTGC 4 cut(s) 2135, 2169, 5171, 5205
BciT130I CCWGG 6 cut(s) 1128, 1614, 3155, 4742, 5881, 6201
BciVI GTATCC 3 cut(s) 79, 1373, 6236
BclI TGATCA 6 cut(s) 1558, 4306, 4990, 5398, 5470, 6478
BcnI CCSGG 7 cut(s) 1306, 2618, 3174, 3175, 3911, 4242, 6062
BcoDI GTCTC 8 cut(s) 2561, 2695, 2992, 2997, 4009, 4679, 5672, 6958
BfmI CTRYAG 8 cut(s) 2129, 2166, 3453, 3720, 4551, 4820, 5545, 6720
BfoI RGCGCY 2 cut(s) 533, 1068
BfrI CTTAAG 1 cut(s) 2914
BfuAI ACCTGC 3 cut(s) 2159, 3157, 4827
BfuI GTATCC 3 cut(s) 79, 1373, 6236
BglII AGATCT 2 cut(s) 4751, 6990
BlpI GCTNAGC 2 cut(s) 4458, 5424
BmcAI AGTACT 2 cut(s) 2862, 3953
Bme18I GGWCC 5 cut(s) 620, 1498, 1610, 3073, 4868
BmeRI GACNNNNNGTC 1 cut(s) 2553
BmeT110I CYCGRG 5 cut(s) 185, 3173, 4412, 5726, 6584
BmgBI CACGTC 4 cut(s) 361, 4583, 4880, 6752
BmgT120I GGNCC 7 cut(s) 620, 1498, 1610, 3073, 4868, 6496, 6497
BmrI ACTGGG 1 cut(s) 2846
BmtI GCTAGC 1 cut(s) 1383
BmuI ACTGGG 1 cut(s) 2846
BpiI GAAGAC 8 cut(s) 73, 108, 343, 2957, 3051, 3428, 3699, 5292
BpmI CTGGAG 5 cut(s) 1746, 2585, 4046, 5214, 7007
Bpu10I CCTNAGC 3 cut(s) 86, 539, 3760
Bpu1102I GCTNAGC 2 cut(s) 4458, 5424
Bpu14I TTCGAA 2 cut(s) 5245, 6666
BpuEI CTTGAG 5 cut(s) 1189, 2117, 3764, 4520, 7013
BpuMI CCSGG 7 cut(s) 1306, 2618, 3174, 3175, 3911, 4242, 6062
Bsa29I ATCGAT 2 cut(s) 1587, 5191
BsaBI GATNNNNATC 5 cut(s) 1361, 4254, 4311, 6414, 6483
BsaHI GRCGYC 1 cut(s) 3001
BsaI GGTCTC 3 cut(s) 4009, 4679, 6958
BsaWI WCCGGW 8 cut(s) 637, 966, 2801, 3224, 4018, 4175, 4509, 5176
Bse118I RCCGGY 3 cut(s) 4509, 5259, 5641
Bse1I ACTGG 8 cut(s) 347, 711, 827, 1501, 2484, 2841, 3243, 6375
Bse21I CCTNAGG 1 cut(s) 7017
Bse3DI GCAATG 4 cut(s) 2336, 4276, 5732, 6981
Bse8I GATNNNNATC 5 cut(s) 1361, 4254, 4311, 6414, 6483
BseAI TCCGGA 2 cut(s) 2801, 5176
BseBI CCWGG 6 cut(s) 1128, 1614, 3155, 4742, 5881, 6201
BseCI ATCGAT 2 cut(s) 1587, 5191
BseJI GATNNNNATC 5 cut(s) 1361, 4254, 4311, 6414, 6483
BseMI GCAATG 4 cut(s) 2336, 4276, 5732, 6981
BseNI ACTGG 8 cut(s) 347, 711, 827, 1501, 2484, 2841, 3243, 6375
BseRI GAGGAG 2 cut(s) 308, 711
BseSI GKGCMC 4 cut(s) 3174, 4399, 6500, 6571
BseYI CCCAGC 3 cut(s) 1672, 2176, 3914
Bsh1236I CGCG 1 cut(s) 5166
Bsh1285I CGRYCG 1 cut(s) 7003
BshNI GGYRCC 2 cut(s) 3169, 4189
BshTI ACCGGT 1 cut(s) 4509
BshVI ATCGAT 2 cut(s) 1587, 5191
BsiEI CGRYCG 1 cut(s) 7003
BsiHKAI GWGCWC 7 cut(s) 974, 1205, 1539, 3236, 4399, 4860, 6571
BsiHKCI CYCGRG 5 cut(s) 185, 3173, 4412, 5726, 6584
BsmAI GTCTC 8 cut(s) 2561, 2695, 2992, 2997, 4009, 4679, 5672, 6958
BsmBI CGTCTC 1 cut(s) 2992
BsmI GAATGC 1 cut(s) 164
Bso31I GGTCTC 3 cut(s) 4009, 4679, 6958
BsoBI CYCGRG 5 cut(s) 185, 3173, 4412, 5726, 6584
Bsp119I TTCGAA 2 cut(s) 5245, 6666
Bsp120I GGGCCC 1 cut(s) 6496
Bsp13I TCCGGA 2 cut(s) 2801, 5176
Bsp1407I TGTACA 1 cut(s) 5310
Bsp1720I GCTNAGC 2 cut(s) 4458, 5424
Bsp19I CCATGG 1 cut(s) 524
BspDI ATCGAT 2 cut(s) 1587, 5191
BspEI TCCGGA 2 cut(s) 2801, 5176
BspFNI CGCG 1 cut(s) 5166
BspHI TCATGA 3 cut(s) 1594, 2257, 6897
BspMAI CTGCAG 3 cut(s) 2170, 4555, 4824
BspMI ACCTGC 3 cut(s) 2159, 3157, 4827
BspOI GCTAGC 1 cut(s) 1383
BspT104I TTCGAA 2 cut(s) 5245, 6666
BspT107I GGYRCC 2 cut(s) 3169, 4189
BspTI CTTAAG 1 cut(s) 2914
BspTNI GGTCTC 3 cut(s) 4009, 4679, 6958
BsrDI GCAATG 4 cut(s) 2336, 4276, 5732, 6981
BsrFI RCCGGY 3 cut(s) 4509, 5259, 5641
BsrGI TGTACA 1 cut(s) 5310
BsrI ACTGG 8 cut(s) 347, 711, 827, 1501, 2484, 2841, 3243, 6375
BssAI RCCGGY 3 cut(s) 4509, 5259, 5641
BssNAI GTATAC 2 cut(s) 1478, 3353
BssNI GRCGYC 1 cut(s) 3001
BssSI CACGAG 3 cut(s) 491, 2740, 5963
BssT1I CCWWGG 5 cut(s) 524, 2296, 3195, 3862, 4158
Bst1107I GTATAC 2 cut(s) 1478, 3353
Bst2BI CACGAG 3 cut(s) 491, 2740, 5963
Bst2UI CCWGG 6 cut(s) 1128, 1614, 3155, 4742, 5881, 6201
Bst6I CTCTTC 3 cut(s) 40, 490, 1725
BstACI GRCGYC 1 cut(s) 3001
BstAFI CTTAAG 1 cut(s) 2914
BstAPI GCANNNNNTGC 1 cut(s) 5662
BstAUI TGTACA 1 cut(s) 5310
BstBI TTCGAA 2 cut(s) 5245, 6666
BstDSI CCRYGG 1 cut(s) 524
BstENI CCTNNNNNAGG 2 cut(s) 4622, 6791
BstFNI CGCG 1 cut(s) 5166
BstH2I RGCGCY 2 cut(s) 533, 1068
BstHHI GCGC 6 cut(s) 532, 1067, 2367, 4283, 5210, 7024
BstMAI GTCTC 8 cut(s) 2561, 2695, 2992, 2997, 4009, 4679, 5672, 6958
BstMCI CGRYCG 1 cut(s) 7003
BstNI CCWGG 6 cut(s) 1128, 1614, 3155, 4742, 5881, 6201
BstSFI CTRYAG 8 cut(s) 2129, 2166, 3453, 3720, 4551, 4820, 5545, 6720
BstSLI GKGCMC 4 cut(s) 3174, 4399, 6500, 6571
BstUI CGCG 1 cut(s) 5166
BstV2I GAAGAC 8 cut(s) 73, 108, 343, 2957, 3051, 3428, 3699, 5292
BstXI CCANNNNNNTGG 1 cut(s) 2697
BstZ17I GTATAC 2 cut(s) 1478, 3353
Bsu15I ATCGAT 2 cut(s) 1587, 5191
Bsu36I CCTNAGG 1 cut(s) 7017
BsuI GTATCC 3 cut(s) 79, 1373, 6236
BsuTUI ATCGAT 2 cut(s) 1587, 5191
BtgI CCRYGG 1 cut(s) 524
BtgZI GCGATG 2 cut(s) 559, 908
BtrI CACGTC 4 cut(s) 361, 4583, 4880, 6752
BtsI GCAGTG 4 cut(s) 1813, 3090, 5802, 6277
BveI ACCTGC 3 cut(s) 2159, 3157, 4827
CciI TCATGA 3 cut(s) 1594, 2257, 6897
CfoI GCGC 6 cut(s) 532, 1067, 2367, 4283, 5210, 7024
Cfr10I RCCGGY 3 cut(s) 4509, 5259, 5641
Cfr13I GGNCC 7 cut(s) 620, 1498, 1610, 3073, 4868, 6496, 6497
Cfr9I CCCGGG 1 cut(s) 3173
ClaI ATCGAT 2 cut(s) 1587, 5191
CseI GACGC 2 cut(s) 1071, 2168
Csp6I GTAC 8 cut(s) 2593, 2861, 3122, 3846, 3952, 5311, 5816, 6891
CspAI ACCGGT 1 cut(s) 4509
CviQI GTAC 8 cut(s) 2593, 2861, 3122, 3846, 3952, 5311, 5816, 6891
DraI TTTAAA 4 cut(s) 747, 2731, 3853, 5793
DriI GACNNNNNGTC 1 cut(s) 2553
EaeI YGGCCR 2 cut(s) 5754, 5994
Eam1104I CTCTTC 3 cut(s) 40, 490, 1725
Eam1105I GACNNNNNGTC 1 cut(s) 2553
EarI CTCTTC 3 cut(s) 40, 490, 1725
EciI GGCGGA 1 cut(s) 506
Ecl136II GAGCTC 1 cut(s) 3234
Eco130I CCWWGG 5 cut(s) 524, 2296, 3195, 3862, 4158
Eco147I AGGCCT 1 cut(s) 4410
Eco24I GRGCYC 4 cut(s) 47, 3236, 4328, 6500
Eco31I GGTCTC 3 cut(s) 4009, 4679, 6958
Eco32I GATATC 2 cut(s) 511, 2056
Eco47I GGWCC 5 cut(s) 620, 1498, 1610, 3073, 4868
Eco53kI GAGCTC 1 cut(s) 3234
Eco81I CCTNAGG 1 cut(s) 7017
Eco88I CYCGRG 5 cut(s) 185, 3173, 4412, 5726, 6584
EcoICRI GAGCTC 1 cut(s) 3234
EcoNI CCTNNNNNAGG 2 cut(s) 4622, 6791
EcoO109I RGGNCCY 3 cut(s) 3073, 6496, 6497
EcoRI GAATTC 7 cut(s) 2209, 3672, 3715, 4556, 5431, 6701, 6725
EcoRII CCWGG 6 cut(s) 1126, 1612, 3153, 4740, 5879, 6199
EcoRV GATATC 2 cut(s) 511, 2056
EcoT14I CCWWGG 5 cut(s) 524, 2296, 3195, 3862, 4158
EcoT22I ATGCAT 2 cut(s) 166, 2121
EcoT38I GRGCYC 4 cut(s) 47, 3236, 4328, 6500
ErhI CCWWGG 5 cut(s) 524, 2296, 3195, 3862, 4158
Esp3I CGTCTC 1 cut(s) 2992
FauI CCCGC 1 cut(s) 116
FauNDI CATATG 1 cut(s) 4873
FbaI TGATCA 6 cut(s) 1558, 4306, 4990, 5398, 5470, 6478
FblI GTMKAC 5 cut(s) 1477, 3352, 4132, 4686, 6855
FriOI GRGCYC 4 cut(s) 47, 3236, 4328, 6500
FspI TGCGCA 1 cut(s) 2366
GlaI GCGC 6 cut(s) 531, 1066, 2366, 4282, 5209, 7023
GsaI CCCAGC 3 cut(s) 1676, 2180, 3918
GsuI CTGGAG 5 cut(s) 1746, 2585, 4046, 5214, 7007
HaeII RGCGCY 2 cut(s) 533, 1068
HgaI GACGC 2 cut(s) 1071, 2168
HhaI GCGC 6 cut(s) 532, 1067, 2367, 4283, 5210, 7024
Hin1I GRCGYC 1 cut(s) 3001
Hin6I GCGC 6 cut(s) 530, 1065, 2365, 4281, 5208, 7022
HinP1I GCGC 6 cut(s) 530, 1065, 2365, 4281, 5208, 7022
HincII GTYRAC 4 cut(s) 327, 2398, 2652, 6628
HindII GTYRAC 4 cut(s) 327, 2398, 2652, 6628
HindIII AAGCTT 5 cut(s) 1004, 1740, 2034, 2971, 3413
HphI GGTGA 8 cut(s) 110, 2183, 2260, 2678, 4316, 4499, 6488, 6668
Hpy99I CGWCG 3 cut(s) 365, 5087, 7001
Hsp92I GRCGYC 1 cut(s) 3001
HspAI GCGC 6 cut(s) 530, 1065, 2365, 4281, 5208, 7022
Kpn2I TCCGGA 2 cut(s) 2801, 5176
Ksp22I TGATCA 6 cut(s) 1558, 4306, 4990, 5398, 5470, 6478
MfeI CAATTG 3 cut(s) 786, 2286, 3206
MlsI TGGCCA 2 cut(s) 5756, 5996
MluI ACGCGT 1 cut(s) 5164
MluNI TGGCCA 2 cut(s) 5756, 5996
MmeI TCCRAC 9 cut(s) 758, 2454, 3309, 3803, 4743, 5106, 5383, 5584, 6015
Mox20I TGGCCA 2 cut(s) 5756, 5996
Mph1103I ATGCAT 2 cut(s) 166, 2121
MroI TCCGGA 2 cut(s) 2801, 5176
MroXI GAANNNNTTC 9 cut(s) 903, 1155, 1719, 1742, 3630, 3888, 5522, 6410, 6672
MscI TGGCCA 2 cut(s) 5756, 5996
MslI CAYNNNNRTG 7 cut(s) 3731, 4941, 5664, 5908, 5910, 5973, 6105
Msp20I TGGCCA 2 cut(s) 5756, 5996
MspA1I CMGCKG 4 cut(s) 1073, 2165, 4215, 5423
MspCI CTTAAG 1 cut(s) 2914
MunI CAATTG 3 cut(s) 786, 2286, 3206
Mva1269I GAATGC 1 cut(s) 164
MvaI CCWGG 6 cut(s) 1128, 1614, 3155, 4742, 5881, 6201
MvnI CGCG 1 cut(s) 5166
NciI CCSGG 7 cut(s) 1306, 2618, 3174, 3175, 3911, 4242, 6062
NcoI CCATGG 1 cut(s) 524
NdeI CATATG 1 cut(s) 4873
NheI GCTAGC 1 cut(s) 1379
NmeAIII GCCGAG 3 cut(s) 4673, 4851, 6842
NmuCI GTSAC 7 cut(s) 713, 934, 3803, 4613, 5195, 6053, 6782
NsbI TGCGCA 1 cut(s) 2366
NsiI ATGCAT 2 cut(s) 166, 2121
NspV TTCGAA 2 cut(s) 5245, 6666
PacI TTAATTAA 1 cut(s) 2091
PaeI GCATGC 1 cut(s) 3560
PaeR7I CTCGAG 4 cut(s) 185, 4412, 5726, 6584
PagI TCATGA 3 cut(s) 1594, 2257, 6897
PaqCI CACCTGC 2 cut(s) 2159, 3157
PceI AGGCCT 1 cut(s) 4410
PciI ACATGT 5 cut(s) 1185, 1197, 3922, 5905, 6400
PcsI WCGNNNNNNNCGW 2 cut(s) 2064, 5867
PctI GAATGC 1 cut(s) 164
PdmI GAANNNNTTC 9 cut(s) 903, 1155, 1719, 1742, 3630, 3888, 5522, 6410, 6672
PflMI CCANNNNNTGG 2 cut(s) 2605, 2642
PfoI TCCNGGA 3 cut(s) 1304, 4240, 4740
PinAI ACCGGT 1 cut(s) 4509
Ple19I CGATCG 1 cut(s) 7003
PpuMI RGGWCCY 1 cut(s) 3073
PscI ACATGT 5 cut(s) 1185, 1197, 3922, 5905, 6400
PshBI ATTAAT 2 cut(s) 2928, 6206
PsiI TTATAA 2 cut(s) 1631, 6189
Psp124BI GAGCTC 1 cut(s) 3236
Psp1406I AACGTT 1 cut(s) 6012
Psp5II RGGWCCY 1 cut(s) 3073
Psp6I CCWGG 6 cut(s) 1126, 1612, 3153, 4740, 5879, 6199
PspFI CCCAGC 3 cut(s) 1672, 2176, 3914
PspGI CCWGG 6 cut(s) 1126, 1612, 3153, 4740, 5879, 6199
PspOMI GGGCCC 1 cut(s) 6496
PspPI GGNCC 7 cut(s) 620, 1498, 1610, 3073, 4868, 6496, 6497
PspPPI RGGWCCY 1 cut(s) 3073
PstI CTGCAG 3 cut(s) 2170, 4555, 4824
PvuI CGATCG 1 cut(s) 7003
PvuII CAGCTG 2 cut(s) 2165, 4215
RsaI GTAC 8 cut(s) 2594, 2862, 3123, 3847, 3953, 5312, 5817, 6892
RsaNI GTAC 8 cut(s) 2593, 2861, 3122, 3846, 3952, 5311, 5816, 6891
RseI CAYNNNNRTG 7 cut(s) 3731, 4941, 5664, 5908, 5910, 5973, 6105
SacI GAGCTC 1 cut(s) 3236
Sau96I GGNCC 7 cut(s) 620, 1498, 1610, 3073, 4868, 6496, 6497
ScaI AGTACT 2 cut(s) 2862, 3953
SfcI CTRYAG 8 cut(s) 2129, 2166, 3453, 3720, 4551, 4820, 5545, 6720
Sfr274I CTCGAG 4 cut(s) 185, 4412, 5726, 6584
SfuI TTCGAA 2 cut(s) 5245, 6666
SinI GGWCC 5 cut(s) 620, 1498, 1610, 3073, 4868
SlaI CTCGAG 4 cut(s) 185, 4412, 5726, 6584
SmaI CCCGGG 1 cut(s) 3175
SmiMI CAYNNNNRTG 7 cut(s) 3731, 4941, 5664, 5908, 5910, 5973, 6105
SphI GCATGC 1 cut(s) 3560
SseBI AGGCCT 1 cut(s) 4410
SspI AATATT 4 cut(s) 1802, 2084, 5535, 5744
SstI GAGCTC 1 cut(s) 3236
StuI AGGCCT 1 cut(s) 4410
StyI CCWWGG 5 cut(s) 524, 2296, 3195, 3862, 4158
TatI WGTACW 6 cut(s) 2860, 3121, 3845, 3951, 5310, 5815
TauI GCSGC 3 cut(s) 151, 1317, 2532
TseFI GTSAC 7 cut(s) 713, 934, 3803, 4613, 5195, 6053, 6782
Tsp45I GTSAC 7 cut(s) 713, 934, 3803, 4613, 5195, 6053, 6782
TspMI CCCGGG 1 cut(s) 3173
Van91I CCANNNNNTGG 2 cut(s) 2605, 2642
Vha464I CTTAAG 1 cut(s) 2914
VneI GTGCAC 2 cut(s) 4395, 6567
VpaK11BI GGWCC 5 cut(s) 620, 1498, 1610, 3073, 4868
VspI ATTAAT 2 cut(s) 2928, 6206
XagI CCTNNNNNAGG 2 cut(s) 4622, 6791
XbaI TCTAGA 7 cut(s) 1546, 2746, 4594, 4801, 4975, 6763, 6934
XcmI CCANNNNNNNNNTGG 2 cut(s) 5366, 5567
XhoI CTCGAG 4 cut(s) 185, 4412, 5726, 6584
XmaI CCCGGG 1 cut(s) 3173
XmiI GTMKAC 5 cut(s) 1477, 3352, 4132, 4686, 6855
XmnI GAANNNNTTC 9 cut(s) 903, 1155, 1719, 1742, 3630, 3888, 5522, 6410, 6672
ZraI GACGTC 1 cut(s) 3002
ZrmI AGTACT 2 cut(s) 2862, 3953
Zsp2I ATGCAT 2 cut(s) 166, 2121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.