Rmu_sc0008351.1_g000022

EF hand

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008351.1
Physical Location & Seq
Forward (+)
105598 .. 106915
1318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008351.1_g000022.1.cds

Sequence Viewer

Length: 669 bp
atggaagaaatacgtgaggctgctttagcttactaccataacttgccagaagacctacagaagctggcatctgaaaaattcaaagaaattgattcaaatggtaatggcacaataagcatcagggaattcaagaagagtatgggaagctctttcgacaatgactccgtgatcatgaagagaagcttcaaggagctggacaagaacggagacggcaagttggatttcaacgaatacatcactctatactatcttgtagagagcggtagggtgctgatttattgtgcgggcgatggatgtgaggccgcaccttttctcaagggactctattttacttgcgtcgactgcttccaccataacgaaaatgaaactttcgatctctgcacctcctgctaccgcaatgctgactttgttcatgaacacaccaactttgtggataaccatgtgttacttcgttccaaggctgcttgttgtgaatccacatctgagccatgctcttctgggcctgattctgagtccaatcaagttagtcgatctggatcaaagagagtggaagttaagcgatctggatcaaagaggagggcagtatttggtgcaatcaattctggagtgagcgttgcacaggcagtaggaagtgttgcagctgatgctgcttcatgcagtatcatgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

222

Amino Acids

24.46

Weight (kDa)

5.42

Isoelectric Point (pI)

44.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000286)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G13440 AT4G13440
fragaria_vesca FvH4_3g15000 FvH4_3g15000 FvH4_3g15020 FvH4_4g04740 FvH4_4g04740 FvH4_4g04740 FvH4_4g04760 FvH4_4g04850 FvH4_4g04860 FvH4_4g04900 FvH4_4g04980 FvH4_4g04980 FvH4_4g04990 FvH4_4g04990
malus_domestica MD05G1227800.v1.1 MD05G1228500.v1.1
prunus_persica Prupe.1G049600_v2.0.a1 Prupe.1G049700_v2.0.a1 Prupe.1G049800_v2.0.a1 Prupe.1G050000_v2.0.a1 Prupe.1G050100_v2.0.a1 Prupe.4G134500_v2.0.a1 Prupe.6G152600_v2.0.a1
pyrus_communis pycom13g19680 pycom13g19690
rosa_chinensis RchiOBHm_Chr4g0395461 RchiOBHm_Chr4g0395551 RchiOBHm_Chr4g0395571 RchiOBHm_Chr4g0395741 RchiOBHm_Chr4g0395751 RchiOBHm_Chr4g0395781 RchiOBHm_Chr4g0395801 RchiOBHm_Chr4g0397571 RchiOBHm_Chr5g0024631 RchiOBHm_Chr5g0024661
rosa_laevigata RLG00000009594 RLG00000009595 RLG00000009596 RLG00000009607 RLG00000009608 RLG00000009610 RLG00000009612 RLG00000009621 RLG00000032811
rosa_multiflora Rmu_co8376147.1_g000001 Rmu_sc0000041.1_g000020 Rmu_sc0001103.1_g000038 Rmu_sc0001757.1_g000010 Rmu_sc0004598.1_g000029 Rmu_sc0004849.1_g000001 Rmu_sc0005389.1_g000025 Rmu_sc0005431.1_g000010 Rmu_sc0005431.1_g000020 Rmu_sc0005653.1_g000008 Rmu_sc0008351.1_g000022 Rmu_sc0011701.1_g000009
rosa_roxburghii Rroxscaffold_1G00054620 Rroxscaffold_1G00054630 Rroxscaffold_1G00054640 Rroxscaffold_5G00340400 Rroxscaffold_5G00340540 Rroxscaffold_5G00340550 Rroxscaffold_5G00340590 Rroxscaffold_5G00340630 Rroxscaffold_5G00340640 Rroxscaffold_5G00340760
rosa_rugosa Rorug03G0342500 Rorug03G0354500 Rorug03G0355100 Rorug03G0355200 Rorug03G0355300 Rorug03G0356100 Rorug03G0356400 Rorug03G0356500 Rorug05G0084400
rosa_samantha Rh4AG060000 Rh4AG060900 Rh4AG061200 Rh4BG058600 Rh4BG060300 Rh4BG060500 Rh4BG061200 Rh4BG061400 Rh4BG061700 Rh4BG062000 Rh4BG062100 Rh4BG077000 Rh4CG064400 Rh4CG064600 Rh4CG065900 Rh4CG066000 Rh4CG066300 Rh4CG067400 Rh4CG068000 Rh4CG068300 Rh4CG068400 Rh4CG084600 Rh4DG056100 Rh4DG056200 Rh4DG056600 Rh4DG056800 Rh4DG056900 Rh4DG057000 Rh4DG072000 Rh5BG173500 Rh5CG189600 Rh5CG190000
rosa_wichuraiana Rw0G006720 Rw0G022980 Rw0G023000 Rw2G038350 Rw4G004810 Rw4G004850 Rw4G004870 Rw4G004880 Rw4G004990 Rw4G005000 Rw4G005080 Rw4G005110 Rw4G005120 Rw4G005130 Rw4G006450 Rw5G015940

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 261
AccI GTMKAC 1 cut(s) 339
AciI CCGC 4 cut(s) 261, 284, 303, 394
AclWI GGATC 2 cut(s) 544, 574
AcsI RAATTY 2 cut(s) 77, 125
AgsI TTSAA 5 cut(s) 82, 96, 130, 187, 226
AluBI AGCT 6 cut(s) 29, 64, 147, 183, 193, 641
AluI AGCT 6 cut(s) 29, 64, 147, 183, 193, 641
Alw26I GTCTC 1 cut(s) 201
AlwI GGATC 2 cut(s) 544, 574
AlwNI CAGNNNCTG 1 cut(s) 64
AoxI GGCC 2 cut(s) 300, 500
ApeKI GCWGC 4 cut(s) 20, 461, 638, 647
ApoI RAATTY 2 cut(s) 77, 125
AspS9I GGNCC 1 cut(s) 500
BbsI GAAGAC 1 cut(s) 57
BbvI GCAGC 4 cut(s) 7, 448, 634, 650
BccI CCATC 1 cut(s) 284
BceAI ACGGC 1 cut(s) 226
BclI TGATCA 1 cut(s) 168
BcoDI GTCTC 1 cut(s) 201
BfmI CTRYAG 1 cut(s) 56
BisI GCNGC 5 cut(s) 21, 303, 462, 639, 648
BlsI GCNGC 5 cut(s) 22, 304, 463, 640, 649
BmgT120I GGNCC 1 cut(s) 500
BmsI GCATC 3 cut(s) 77, 126, 634
BpiI GAAGAC 1 cut(s) 57
BplI GAGNNNNNCTC 2 cut(s) 476, 508
BpmI CTGGAG 1 cut(s) 624
BpuEI CTTGAG 1 cut(s) 299
BsaAI YACGTR 1 cut(s) 14
BsaBI GATNNNNATC 2 cut(s) 535, 565
BsaJI CCNNGG 1 cut(s) 456
BsaXI ACNNNNNCTCC 4 cut(s) 146, 176, 597, 627
Bse3DI GCAATG 1 cut(s) 403
Bse8I GATNNNNATC 2 cut(s) 535, 565
BseDI CCNNGG 1 cut(s) 456
BseGI GGATG 1 cut(s) 299
BseJI GATNNNNATC 2 cut(s) 535, 565
BseMI GCAATG 1 cut(s) 403
BseMII CTCAG 2 cut(s) 474, 501
BseRI GAGGAG 1 cut(s) 589
BseXI GCAGC 4 cut(s) 7, 448, 634, 650
BsgI GTGCAG 1 cut(s) 364
BshFI GGCC 2 cut(s) 302, 502
BslFI GGGAC 1 cut(s) 333
BsmAI GTCTC 1 cut(s) 201
BsmBI CGTCTC 1 cut(s) 201
BsmFI GGGAC 1 cut(s) 333
BsnI GGCC 2 cut(s) 302, 502
Bsp143I GATC 6 cut(s) 168, 373, 530, 536, 560, 566
BspACI CCGC 4 cut(s) 261, 284, 303, 394
BspANI GGCC 2 cut(s) 302, 502
BspCNI CTCAG 2 cut(s) 475, 502
BspHI TCATGA 2 cut(s) 171, 412
BspPI GGATC 2 cut(s) 544, 574
BspQI GCTCTTC 1 cut(s) 499
BsrBI CCGCTC 1 cut(s) 261
BsrDI GCAATG 1 cut(s) 403
BssECI CCNNGG 1 cut(s) 456
BssMI GATC 6 cut(s) 168, 373, 530, 536, 560, 566
BssT1I CCWWGG 1 cut(s) 456
Bst6I CTCTTC 3 cut(s) 128, 170, 499
BstAPI GCANNNNNTGC 2 cut(s) 387, 644
BstBAI YACGTR 1 cut(s) 14
BstC8I GCNNGC 2 cut(s) 66, 286
BstDEI CTNAG 2 cut(s) 483, 510
BstF5I GGATG 1 cut(s) 299
BstKTI GATC 6 cut(s) 171, 376, 533, 539, 563, 569
BstMAI GTCTC 1 cut(s) 201
BstMBI GATC 6 cut(s) 168, 373, 530, 536, 560, 566
BstMWI GCNNNNNNNGC 6 cut(s) 26, 114, 342, 387, 644, 647
BstSFI CTRYAG 1 cut(s) 56
BstV1I GCAGC 4 cut(s) 7, 448, 634, 650
BstV2I GAAGAC 1 cut(s) 57
BstXI CCANNNNNNTGG 1 cut(s) 430
BsuRI GGCC 2 cut(s) 302, 502
BtgZI GCGATG 1 cut(s) 303
BtsCI GGATG 1 cut(s) 299
Cac8I GCNNGC 2 cut(s) 66, 286
CaiI CAGNNNCTG 1 cut(s) 64
CciI TCATGA 2 cut(s) 171, 412
Cfr13I GGNCC 1 cut(s) 500
CseI GACGC 1 cut(s) 325
CspCI CAANNNNNGTGG 2 cut(s) 528, 563
CviAII CATG 6 cut(s) 172, 413, 440, 489, 654, 664
DdeI CTNAG 2 cut(s) 483, 510
DpnI GATC 6 cut(s) 170, 375, 532, 538, 562, 568
DpnII GATC 6 cut(s) 168, 373, 530, 536, 560, 566
Eam1104I CTCTTC 3 cut(s) 128, 170, 499
EarI CTCTTC 3 cut(s) 128, 170, 499
Eco130I CCWWGG 1 cut(s) 456
EcoRI GAATTC 1 cut(s) 125
EcoT14I CCWWGG 1 cut(s) 456
ErhI CCWWGG 1 cut(s) 456
Esp3I CGTCTC 1 cut(s) 201
FaeI CATG 6 cut(s) 175, 416, 443, 492, 657, 667
FalI AAGNNNNNCTT 2 cut(s) 167, 199
FaqI GGGAC 1 cut(s) 333
FatI CATG 6 cut(s) 171, 412, 439, 488, 653, 663
FauI CCCGC 1 cut(s) 277
FbaI TGATCA 1 cut(s) 168
FblI GTMKAC 1 cut(s) 339
Fnu4HI GCNGC 5 cut(s) 21, 303, 462, 639, 648
FokI GGATG 1 cut(s) 306
Fsp4HI GCNGC 5 cut(s) 21, 303, 462, 639, 648
GluI GCNGC 5 cut(s) 21, 303, 462, 639, 648
GsuI CTGGAG 1 cut(s) 624
HaeIII GGCC 2 cut(s) 302, 502
HgaI GACGC 1 cut(s) 325
Hin1II CATG 6 cut(s) 175, 416, 443, 492, 657, 667
HincII GTYRAC 1 cut(s) 340
HindII GTYRAC 1 cut(s) 340
HindIII AAGCTT 1 cut(s) 181
HinfI GANTC 6 cut(s) 92, 161, 321, 473, 506, 512
Hpy166II GTNNAC 1 cut(s) 340
Hpy188I TCNGA 3 cut(s) 73, 484, 511
Hpy188III TCNNGA 6 cut(s) 130, 172, 413, 534, 564, 603
Hpy8I GTNNAC 1 cut(s) 340
Hpy99I CGWCG 1 cut(s) 341
HpyCH4IV ACGT 1 cut(s) 13
HpyCH4V TGCA 5 cut(s) 381, 593, 617, 638, 657
HpyF10VI GCNNNNNNNGC 6 cut(s) 26, 114, 342, 387, 644, 647
HpyF3I CTNAG 2 cut(s) 483, 510
HpySE526I ACGT 1 cut(s) 13
Hsp92II CATG 6 cut(s) 175, 416, 443, 492, 657, 667
Ksp22I TGATCA 1 cut(s) 168
Kzo9I GATC 6 cut(s) 168, 373, 530, 536, 560, 566
LguI GCTCTTC 1 cut(s) 499
LmnI GCTCC 1 cut(s) 190
Lsp1109I GCAGC 4 cut(s) 7, 448, 634, 650
LweI GCATC 3 cut(s) 77, 126, 634
MaeII ACGT 1 cut(s) 13
MaeIII GTNAC 1 cut(s) 444
MalI GATC 6 cut(s) 170, 375, 532, 538, 562, 568
MbiI CCGCTC 1 cut(s) 261
MboI GATC 6 cut(s) 168, 373, 530, 536, 560, 566
MboII GAAGA 5 cut(s) 17, 62, 145, 187, 486
MluCI AATT 4 cut(s) 77, 87, 125, 598
MlyI GAGTC 3 cut(s) 155, 315, 521
MmeI TCCRAC 1 cut(s) 198
MnlI CCTC 5 cut(s) 10, 292, 394, 567, 570
MseI TTAA 1 cut(s) 555
MspA1I CMGCKG 1 cut(s) 641
MwoI GCNNNNNNNGC 6 cut(s) 26, 114, 342, 387, 644, 647
NdeII GATC 6 cut(s) 168, 373, 530, 536, 560, 566
NlaIII CATG 6 cut(s) 175, 416, 443, 492, 657, 667
PagI TCATGA 2 cut(s) 171, 412
PciSI GCTCTTC 1 cut(s) 499
PfeI GAWTC 3 cut(s) 92, 473, 506
PkrI GCNGC 5 cut(s) 22, 304, 463, 640, 649
PleI GAGTC 3 cut(s) 155, 315, 520
PpsI GAGTC 3 cut(s) 155, 315, 520
Ppu21I YACGTR 1 cut(s) 14
PspPI GGNCC 1 cut(s) 500
PstNI CAGNNNCTG 1 cut(s) 64
PvuII CAGCTG 1 cut(s) 641
SalI GTCGAC 1 cut(s) 338
SapI GCTCTTC 1 cut(s) 499
SaqAI TTAA 1 cut(s) 555
SatI GCNGC 5 cut(s) 21, 303, 462, 639, 648
Sau3AI GATC 6 cut(s) 168, 373, 530, 536, 560, 566
Sau96I GGNCC 1 cut(s) 500
SchI GAGTC 3 cut(s) 155, 315, 521
SfaNI GCATC 3 cut(s) 77, 126, 634
SfcI CTRYAG 1 cut(s) 56
SmlI CTYRAG 1 cut(s) 314
SmoI CTYRAG 1 cut(s) 314
Sse9I AATT 4 cut(s) 77, 87, 125, 598
SsiI CCGC 4 cut(s) 261, 284, 303, 394
StyI CCWWGG 1 cut(s) 456
TaiI ACGT 1 cut(s) 16
TaqI TCGA 4 cut(s) 153, 339, 372, 529
TasI AATT 4 cut(s) 77, 87, 125, 598
TauI GCSGC 1 cut(s) 305
TfiI GAWTC 3 cut(s) 92, 473, 506
Tru1I TTAA 1 cut(s) 555
Tru9I TTAA 1 cut(s) 555
TseI GCWGC 4 cut(s) 20, 461, 638, 647
TspDTI ATGAA 5 cut(s) 188, 378, 401, 429, 642
TspGWI ACGGA 2 cut(s) 154, 219
XapI RAATTY 2 cut(s) 77, 125
XmiI GTMKAC 1 cut(s) 339
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.