Rroxscaffold_5G00340550

EF hand

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
9000129 .. 9001866
1738 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00340550.1

Sequence Viewer

Length: 762 bp
ATGGACATGCAAGAAATACACAACGCTGCTTTAGCTTATTACCAGAACTTATCAGATGAGCTAAAGCAGAAGGCATCTGAAAAATTTAAAGAAATGGATTCGAATGATAATGGCACAATAAGCATCAAGGAGTTCCGGTGGAGTTTGGGCAGCTCCGAGATCAAACGCTGCTTCAAGTTGCTGGACAAAACCGGAGACGGCAAGTTGGATTTCAACGAATTCATCACTCTTTACTACCTCGTGGAGAGTGGGAGAGGGATTTTCTGTGACGGCCATGGATGTAAGGCCTCCCCTTTTCTCAACGGACTGTATTTTACTTGCGTTGAGTGCTTCCATAACAACGAAGCTGCAACGTTCGATCTCTGCACCTCCTGCTACCGCGATGGAAAGTATGTTCACAACCATGCCAGCTTTTTGGATAATTACGTCTTGCTGCGTTCTAAGGCTGCTTGTGAATCCACAACACCAACGGAAGATGATCATCATGAGGTAAACGCTGCAGAATCTGCTCAACCAATTAGTCGTGGACTTCAAACTGTTTCCGATCTATTTGGTCGATCTGGGCCGTCTGAAATGCCAAGCTCTCCTAAGAGCGATTCTGAGTCTTTTGAGTCTGATTCTGAGTTCAATGCTGAGTCCAATCAAGTTAGCCAATCTGGGTCTAAAAGAAGGGCAGTATTTGAAGCAATAAAATCACTCAATTCCCAAGTTAGCATTGGAGATGCTGCTGCTGATGAGTCCGATTCCTGCAGCATTATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

253

Amino Acids

28.02

Weight (kDa)

4.8

Isoelectric Point (pI)

56.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_7 PF13499 23 - 79 6.8e-10 EF-hand domain pair
EF-hand_1 PF00036 53 - 77 4.4e-06 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000286)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G13440 AT4G13440
fragaria_vesca FvH4_3g15000 FvH4_3g15000 FvH4_3g15020 FvH4_4g04740 FvH4_4g04740 FvH4_4g04740 FvH4_4g04760 FvH4_4g04850 FvH4_4g04860 FvH4_4g04900 FvH4_4g04980 FvH4_4g04980 FvH4_4g04990 FvH4_4g04990
malus_domestica MD05G1227800.v1.1 MD05G1228500.v1.1
prunus_persica Prupe.1G049600_v2.0.a1 Prupe.1G049700_v2.0.a1 Prupe.1G049800_v2.0.a1 Prupe.1G050000_v2.0.a1 Prupe.1G050100_v2.0.a1 Prupe.4G134500_v2.0.a1 Prupe.6G152600_v2.0.a1
pyrus_communis pycom13g19680 pycom13g19690
rosa_chinensis RchiOBHm_Chr4g0395461 RchiOBHm_Chr4g0395551 RchiOBHm_Chr4g0395571 RchiOBHm_Chr4g0395741 RchiOBHm_Chr4g0395751 RchiOBHm_Chr4g0395781 RchiOBHm_Chr4g0395801 RchiOBHm_Chr4g0397571 RchiOBHm_Chr5g0024631 RchiOBHm_Chr5g0024661
rosa_laevigata RLG00000009594 RLG00000009595 RLG00000009596 RLG00000009607 RLG00000009608 RLG00000009610 RLG00000009612 RLG00000009621 RLG00000032811
rosa_multiflora Rmu_co8376147.1_g000001 Rmu_sc0000041.1_g000020 Rmu_sc0001103.1_g000038 Rmu_sc0001757.1_g000010 Rmu_sc0004598.1_g000029 Rmu_sc0004849.1_g000001 Rmu_sc0005389.1_g000025 Rmu_sc0005431.1_g000010 Rmu_sc0005431.1_g000020 Rmu_sc0005653.1_g000008 Rmu_sc0008351.1_g000022 Rmu_sc0011701.1_g000009
rosa_roxburghii Rroxscaffold_1G00054620 Rroxscaffold_1G00054630 Rroxscaffold_1G00054640 Rroxscaffold_5G00340400 Rroxscaffold_5G00340540 Rroxscaffold_5G00340550 Rroxscaffold_5G00340590 Rroxscaffold_5G00340630 Rroxscaffold_5G00340640 Rroxscaffold_5G00340760
rosa_rugosa Rorug03G0342500 Rorug03G0354500 Rorug03G0355100 Rorug03G0355200 Rorug03G0355300 Rorug03G0356100 Rorug03G0356400 Rorug03G0356500 Rorug05G0084400
rosa_samantha Rh4AG060000 Rh4AG060900 Rh4AG061200 Rh4BG058600 Rh4BG060300 Rh4BG060500 Rh4BG061200 Rh4BG061400 Rh4BG061700 Rh4BG062000 Rh4BG062100 Rh4BG077000 Rh4CG064400 Rh4CG064600 Rh4CG065900 Rh4CG066000 Rh4CG066300 Rh4CG067400 Rh4CG068000 Rh4CG068300 Rh4CG068400 Rh4CG084600 Rh4DG056100 Rh4DG056200 Rh4DG056600 Rh4DG056800 Rh4DG056900 Rh4DG057000 Rh4DG072000 Rh5BG173500 Rh5CG189600 Rh5CG190000
rosa_wichuraiana Rw0G006720 Rw0G022980 Rw0G023000 Rw2G038350 Rw4G004810 Rw4G004850 Rw4G004870 Rw4G004880 Rw4G004990 Rw4G005000 Rw4G005080 Rw4G005110 Rw4G005120 Rw4G005130 Rw4G006450 Rw5G015940

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 381
AciI CCGC 1 cut(s) 379
AclI AACGTT 1 cut(s) 353
AcoI YGGCCR 1 cut(s) 271
AcsI RAATTY 2 cut(s) 83, 218
AgsI TTSAA 5 cut(s) 175, 214, 533, 628, 683
AloI GAACNNNNNNTCC 2 cut(s) 378, 410
AluBI AGCT 6 cut(s) 35, 61, 153, 347, 411, 582
AluI AGCT 6 cut(s) 35, 61, 153, 347, 411, 582
Alw26I GTCTC 1 cut(s) 189
AlwNI CAGNNNCTG 1 cut(s) 506
AoxI GGCC 3 cut(s) 271, 285, 563
ApoI RAATTY 2 cut(s) 83, 218
AspS9I GGNCC 1 cut(s) 563
AsuII TTCGAA 1 cut(s) 101
BauI CACGAG 1 cut(s) 239
BbvI GCAGC 9 cut(s) 13, 155, 162, 334, 420, 433, 484, 712, 715
BccI CCATC 1 cut(s) 377
BceAI ACGGC 3 cut(s) 214, 286, 550
BclI TGATCA 1 cut(s) 478
BcoDI GTCTC 1 cut(s) 189
BfmI CTRYAG 2 cut(s) 498, 748
BmgT120I GGNCC 1 cut(s) 563
BmsI GCATC 3 cut(s) 83, 132, 712
Bpu14I TTCGAA 1 cut(s) 101
BsaBI GATNNNNATC 1 cut(s) 480
BsaJI CCNNGG 1 cut(s) 274
BsaWI WCCGGW 2 cut(s) 135, 191
BsaXI ACNNNNNCTCC 2 cut(s) 122, 152
Bse8I GATNNNNATC 1 cut(s) 480
BseDI CCNNGG 1 cut(s) 274
BseGI GGATG 1 cut(s) 284
BseJI GATNNNNATC 1 cut(s) 480
BseMII CTCAG 3 cut(s) 591, 612, 624
BseXI GCAGC 9 cut(s) 13, 155, 162, 334, 420, 433, 484, 712, 715
BsgI GTGCAG 1 cut(s) 349
Bsh1236I CGCG 1 cut(s) 381
BshFI GGCC 3 cut(s) 273, 287, 565
BsiSI CCGG 2 cut(s) 136, 192
BsmAI GTCTC 1 cut(s) 189
BsmBI CGTCTC 1 cut(s) 189
BsnI GGCC 3 cut(s) 273, 287, 565
Bsp119I TTCGAA 1 cut(s) 101
Bsp143I GATC 5 cut(s) 159, 358, 478, 544, 557
Bsp19I CCATGG 1 cut(s) 274
BspACI CCGC 1 cut(s) 379
BspANI GGCC 3 cut(s) 273, 287, 565
BspCNI CTCAG 3 cut(s) 592, 613, 625
BspFNI CGCG 1 cut(s) 381
BspHI TCATGA 1 cut(s) 484
BspMAI CTGCAG 2 cut(s) 502, 752
BspT104I TTCGAA 1 cut(s) 101
BssECI CCNNGG 1 cut(s) 274
BssMI GATC 5 cut(s) 159, 358, 478, 544, 557
BssSI CACGAG 1 cut(s) 239
BssT1I CCWWGG 1 cut(s) 274
Bst2BI CACGAG 1 cut(s) 239
Bst4CI ACNGT 2 cut(s) 309, 538
BstAPI GCANNNNNTGC 2 cut(s) 372, 506
BstBI TTCGAA 1 cut(s) 101
BstC8I GCNNGC 1 cut(s) 409
BstDEI CTNAG 5 cut(s) 441, 588, 600, 621, 633
BstDSI CCRYGG 1 cut(s) 274
BstF5I GGATG 1 cut(s) 284
BstFNI CGCG 1 cut(s) 381
BstKTI GATC 5 cut(s) 162, 361, 481, 547, 560
BstMAI GTCTC 1 cut(s) 189
BstMBI GATC 5 cut(s) 159, 358, 478, 544, 557
BstMWI GCNNNNNNNGC 5 cut(s) 32, 120, 327, 372, 506
BstNSI RCATGY 1 cut(s) 10
BstSFI CTRYAG 2 cut(s) 498, 748
BstUI CGCG 1 cut(s) 381
BstV1I GCAGC 9 cut(s) 13, 155, 162, 334, 420, 433, 484, 712, 715
BstXI CCANNNNNNTGG 1 cut(s) 415
BsuRI GGCC 3 cut(s) 273, 287, 565
BtgI CCRYGG 1 cut(s) 274
BtgZI GCGATG 1 cut(s) 396
BtsCI GGATG 1 cut(s) 284
Cac8I GCNNGC 1 cut(s) 409
CaiI CAGNNNCTG 1 cut(s) 506
CciI TCATGA 1 cut(s) 484
Cfr13I GGNCC 1 cut(s) 563
CviAII CATG 4 cut(s) 7, 275, 404, 485
DdeI CTNAG 5 cut(s) 441, 588, 600, 621, 633
DpnI GATC 5 cut(s) 161, 360, 480, 546, 559
DpnII GATC 5 cut(s) 159, 358, 478, 544, 557
DraI TTTAAA 1 cut(s) 88
EaeI YGGCCR 1 cut(s) 271
Eco130I CCWWGG 1 cut(s) 274
Eco147I AGGCCT 1 cut(s) 287
EcoRI GAATTC 1 cut(s) 218
EcoT14I CCWWGG 1 cut(s) 274
ErhI CCWWGG 1 cut(s) 274
Esp3I CGTCTC 1 cut(s) 189
FaeI CATG 4 cut(s) 10, 278, 407, 488
FaiI YATR 7 cut(s) 8, 276, 336, 393, 405, 486, 758
FatI CATG 4 cut(s) 6, 274, 403, 484
FbaI TGATCA 1 cut(s) 478
FokI GGATG 1 cut(s) 291
HaeIII GGCC 3 cut(s) 273, 287, 565
HapII CCGG 2 cut(s) 136, 192
Hin1II CATG 4 cut(s) 10, 278, 407, 488
HpaII CCGG 2 cut(s) 136, 192
Hpy166II GTNNAC 3 cut(s) 397, 493, 527
Hpy188I TCNGA 9 cut(s) 55, 79, 157, 544, 571, 601, 616, 622, 742
Hpy188III TCNNGA 1 cut(s) 485
Hpy8I GTNNAC 3 cut(s) 397, 493, 527
HpyAV CCTTC 2 cut(s) 64, 663
HpyCH4III ACNGT 2 cut(s) 309, 538
HpyCH4IV ACGT 2 cut(s) 353, 426
HpyCH4V TGCA 5 cut(s) 10, 350, 366, 500, 750
HpyF10VI GCNNNNNNNGC 5 cut(s) 32, 120, 327, 372, 506
HpyF3I CTNAG 5 cut(s) 441, 588, 600, 621, 633
HpySE526I ACGT 2 cut(s) 353, 426
Hsp92II CATG 4 cut(s) 10, 278, 407, 488
Ksp22I TGATCA 1 cut(s) 478
Kzo9I GATC 5 cut(s) 159, 358, 478, 544, 557
LmnI GCTCC 1 cut(s) 158
LpnPI CCDG 8 cut(s) 56, 149, 167, 205, 385, 421, 546, 642
Lsp1109I GCAGC 9 cut(s) 13, 155, 162, 334, 420, 433, 484, 712, 715
LweI GCATC 3 cut(s) 83, 132, 712
MaeII ACGT 2 cut(s) 353, 426
MaeIII GTNAC 1 cut(s) 266
MalI GATC 5 cut(s) 161, 360, 480, 546, 559
MboI GATC 5 cut(s) 159, 358, 478, 544, 557
MboII GAAGA 1 cut(s) 485
MluCI AATT 5 cut(s) 83, 218, 421, 516, 700
MlyI GAGTC 4 cut(s) 611, 620, 644, 746
MmeI TCCRAC 1 cut(s) 186
MnlI CCTC 5 cut(s) 248, 248, 298, 379, 481
MseI TTAA 1 cut(s) 87
MslI CAYNNNNRTG 1 cut(s) 402
MspI CCGG 2 cut(s) 136, 192
MvnI CGCG 1 cut(s) 381
MwoI GCNNNNNNNGC 5 cut(s) 32, 120, 327, 372, 506
NcoI CCATGG 1 cut(s) 274
NdeII GATC 5 cut(s) 159, 358, 478, 544, 557
NlaIII CATG 4 cut(s) 10, 278, 407, 488
NmuCI GTSAC 1 cut(s) 266
NspI RCATGY 1 cut(s) 10
NspV TTCGAA 1 cut(s) 101
PagI TCATGA 1 cut(s) 484
PceI AGGCCT 1 cut(s) 287
PfeI GAWTC 6 cut(s) 98, 455, 503, 596, 617, 743
PleI GAGTC 4 cut(s) 610, 619, 643, 745
PpsI GAGTC 4 cut(s) 610, 619, 643, 745
Psp1406I AACGTT 1 cut(s) 353
PspPI GGNCC 1 cut(s) 563
PstI CTGCAG 2 cut(s) 502, 752
PstNI CAGNNNCTG 1 cut(s) 506
RseI CAYNNNNRTG 1 cut(s) 402
SaqAI TTAA 1 cut(s) 87
Sau3AI GATC 5 cut(s) 159, 358, 478, 544, 557
Sau96I GGNCC 1 cut(s) 563
SchI GAGTC 4 cut(s) 611, 620, 644, 746
SfaNI GCATC 3 cut(s) 83, 132, 712
SfcI CTRYAG 2 cut(s) 498, 748
SfuI TTCGAA 1 cut(s) 101
SmiMI CAYNNNNRTG 1 cut(s) 402
Sse9I AATT 5 cut(s) 83, 218, 421, 516, 700
SseBI AGGCCT 1 cut(s) 287
SsiI CCGC 1 cut(s) 379
StuI AGGCCT 1 cut(s) 287
StyI CCWWGG 1 cut(s) 274
TaaI ACNGT 2 cut(s) 309, 538
TaiI ACGT 2 cut(s) 356, 429
TaqI TCGA 3 cut(s) 101, 357, 556
TasI AATT 5 cut(s) 83, 218, 421, 516, 700
TfiI GAWTC 6 cut(s) 98, 455, 503, 596, 617, 743
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TseFI GTSAC 1 cut(s) 266
Tsp45I GTSAC 1 cut(s) 266
TspDTI ATGAA 1 cut(s) 211
TspGWI ACGGA 2 cut(s) 318, 485
XapI RAATTY 2 cut(s) 83, 218
XceI RCATGY 1 cut(s) 10
XcmI CCANNNNNNNNNTGG 1 cut(s) 713
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.