Prupe.1G055200_v2.0.a1

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
3892127 .. 3894328
2202 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G055200.1

Sequence Viewer

Length: 1866 bp
ATGAGTGGTGCAAATCTTAGCAAAGCATCTGATTGGTTGCCGGTGACAAACACACTCCCGTCTTTGGTAGAGTACTTGGATATGTCTGATTGTGGACTTTATCACATACCTGGTGGTATTGCCAACATGACTAATCTTAAATTCCTTAATATCCAGGACAACTCTATCAGTTCTTCTATACCTAAATGGTTGTACAGGCTTAGCCATCTTCAGTCCCTAATTTTTTCCTACAATTTTTTTCATGGTGAGATCTCGTCTTCCCTTGGAAACCTCACATCCATTGTCAATCTTGACTTAAATTCTAATCAAGTTGAAGGGAATATCCCAAACTCCTTGGGAAATCTTTGTAAGTTGACTACTCTTGATATGTCGAGGAACAATCTCAATGGAAGCGTGTCAGAAATTTTTGTAAGTTTTTCTAGGTGTAGTTCAGGTCAAATAGAGTCATTGAGTCTGTTTGGGAACAATCTTTCTGGCCAATTAACAGATAAGCTTGATAATTTTGAAAAGTTGCGCGTCCTTGATCTTGCTAATAACTCAATATCAGAAGTTTTGATAATTGGTGATAATAATTTAACAGGTGTTGTCTCTCAACAACATTTCACTAATCTGACAAGATTGGTGCAATTTGAAGCAAGTGGAAATTCATTGACTATTGAAACTACTCCACACTGGCTTCCTCCATTTCAACTTTTTATTTTGGTTTTAAATTCTTGGCATCTGGAGCTATCGGAATTGCCCATGTGGCTTCAGAGTCAAACACAGTTGGAGATTCTTAGCATGCCCAACACAAGAATTTCAGGCAATATTGATCTCTCTCAAAATAAATTGTATGTTGTAAATTTAGAAAGCAACAATTTAATTGGGAATATTCCAAGGTCTTTGGGCTACTTACTCTTCCTCCAATACTTGCACTTGCGCAATAATCACTTGCATGGGGAGTTGCCTCCATATCTAAAGAAATGTACAGATTTGACTATTCTTGACCTTAGTTACAATAAGTTTCTAGGAAAGATACCAATGTGGATTGGAAAAAGCCTTTCAAATTTGGCGGTTCTTAGCCTTCGTTCAAATAAGCTTCATGGCCACATTCCGTACAAACTATGCAGTCTTGCAAATCTCCAAATCTTGGACCTCGCACATAACAATCTCTCAGGAAGAATGCCAAGGTGTTTGTACAATTTTACAGCAATGACCACCCGTTTATACTTTAATCATCCATTTTATATTGTGGGCCGAATAGAGAATGCAAACGTGGTGACAAAAGGCAGAGAAGTGAAATATGGAAACATTCTTCTTAGCTTGGCAATTAGTTTGGACCTTTCAGAGAACATTATCTCTGGAGAAATCCCTGAAGAACTTACCAGCCTCATCTACTTGCAGTCGGTGAATTTGTCTTATAATCTTTTGAGTGGAAGAATCCCTCCCAAGATTGGTGATATGAGAAGGTTAGAATCTCTTGATTTGTCCATGAATCAACTTTGTGGTCAAATTGCTCCAAGTATGTCAAGTTTGACATTTCTCAGTGCCTTGAACTTGTCCTACAATAATTTGACAGGCGAGATTCCGGAAAGCACTCAACTTCAGAGTTTGGATCAATCCAGTTTTATTGGTAATAAACTTTGTGGCCCTCCACTTGAAGTGAACTGCAGTAATACCAATGGGACAGTACCACCGGTAGCCGATCAGAAACACGGAGGAAGTTATTTGCTTGAAGACAGTTGGTTCTTTCTGAGCTTGGGACTAGGATTTCTGTTCGGTTTTTGGAGTGTTCTTGGCTCGTTGTTGTTGAACTTGCCATGGAGCATTGTCTTTTCTCGGTTCCTAAATAGCATTGTGAAGAAGCTTTTATGGGGTAATTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

622

Amino Acids

69.18

Weight (kDa)

6.17

Isoelectric Point (pI)

43.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000281)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g21840 FvH4_5g27300 FvH4_7g26560 FvH4_7g26561 FvH4_7g26564 FvH4_7g26565 FvH4_7g26565 FvH4_7g26566 FvH4_7g26567 FvH4_7g26600 FvH4_7g26610
malus_domestica MD01G1000900.v1.1 MD01G1131400.v1.1 MD01G1165400.v1.1 MD01G1165600.v1.1 MD01G1172100.v1.1 MD01G1172300.v1.1 MD01G1172800.v1.1 MD01G1173000.v1.1 MD01G1174800.v1.1 MD01G1178700.v1.1 MD01G1178900.v1.1 MD01G1179300.v1.1 MD01G1179700.v1.1 MD01G1179800.v1.1 MD01G1180500.v1.1 MD04G1020400.v1.1 MD06G1026600.v1.1 MD08G1144300.v1.1 MD08G1144400.v1.1 MD08G1237900.v1.1 MD08G1238300.v1.1 MD08G1238900.v1.1 MD08G1239000.v1.1 MD08G1239100.v1.1 MD08G1239200.v1.1 MD11G1217100.v1.1 MD15G1414600.v1.1 MD15G1414700.v1.1 MD15G1414900.v1.1 MD15G1415000.v1.1 MD15G1426700.v1.1 MD15G1427000.v1.1 MD15G1429700.v1.1 MD15G1429800.v1.1 MD15G1430200.v1.1 MD15G1430300.v1.1 MD15G1439600.v1.1
prunus_persica Prupe.1G055200_v2.0.a1 Prupe.1G526400_v2.0.a1 Prupe.1G541000_v2.0.a1 Prupe.1G575100_v2.0.a1 Prupe.1G575200_v2.0.a1 Prupe.1G575300_v2.0.a1 Prupe.1G575500_v2.0.a1 Prupe.2G270000_v2.0.a1 Prupe.2G270200_v2.0.a1 Prupe.3G019500_v2.0.a1 Prupe.3G019600_v2.0.a1 Prupe.3G021800_v2.0.a1 Prupe.3G029200_v2.0.a1 Prupe.3G055300_v2.0.a1 Prupe.3G064900_v2.0.a1 Prupe.6G311600_v2.0.a1
pyrus_communis pycom01g18380 pycom01g18440 pycom01g18460 pycom01g18480 pycom01g18930 pycom01g18940 pycom01g18960 pycom01g18990 pycom01g19030 pycom01g19050 pycom01g19070 pycom08g20740 pycom08g20750 pycom11g19100 pycom12g20310 pycom14g10700 pycom15g10840 pycom15g37770 pycom15g37830 pycom15g37860 pycom15g38010 pycom15g38040 pycom15g38750 pycom420g00350 pycom420g00400 pycom420g00410 pycom420g00510 pycom420g00540 pycom976g00210
rosa_chinensis RchiOBHm_Chr1g0373231 RchiOBHm_Chr1g0373241 RchiOBHm_Chr1g0373251
rosa_laevigata RLG00000026834 RLG00000026835 RLG00000026836 RLG00000026837 RLG00000026839 RLG00000026840 RLG00000026841
rosa_multiflora Rmu_co8123616.1_g000001 Rmu_sc0000170.1_g000006 Rmu_sc0000170.1_g000007 Rmu_sc0000170.1_g000009 Rmu_sc0008079.1_g000015 Rmu_sc0013594.1_g000002
rosa_roxburghii Rroxscaffold_4G00284310 Rroxscaffold_4G00284320 Rroxscaffold_4G00284350 Rroxscaffold_4G00284370
rosa_rugosa Rorug01G0376700 Rorug01G0376800
rosa_samantha Rh1BG349500 Rh1CG362800 Rh3BG125200
rosa_wichuraiana Rw0G003040 Rw0G015420 Rw1G034010 Rw1G034020 Rw1G034030 Rw1G034950 Rw1G034960 Rw1G034970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1401
Acc16I TGCGCA 1 cut(s) 920
AccB7I CCANNNNNTGG 1 cut(s) 1129
AccII CGCG 1 cut(s) 516
AccIII TCCGGA 1 cut(s) 1567
AciI CCGC 1 cut(s) 1052
AclWI GGATC 1 cut(s) 1602
AcoI YGGCCR 2 cut(s) 475, 1084
AcsI RAATTY 9 cut(s) 140, 298, 402, 643, 709, 795, 841, 1045, 1390
AcuI CTGAAG 4 cut(s) 194, 734, 1374, 1568
AfaI GTAC 6 cut(s) 74, 194, 967, 1097, 1178, 1671
AfiI CCNNNNNNNGG 3 cut(s) 64, 1129, 1433
AgeI ACCGGT 1 cut(s) 1675
AjnI CCWGG 2 cut(s) 109, 153
AluBI AGCT 6 cut(s) 493, 727, 1078, 1302, 1737, 1846
AluI AGCT 6 cut(s) 493, 727, 1078, 1302, 1737, 1846
Alw26I GTCTC 1 cut(s) 592
AlwI GGATC 1 cut(s) 1602
Aor13HI TCCGGA 1 cut(s) 1567
AoxI GGCC 4 cut(s) 475, 1084, 1234, 1627
ApoI RAATTY 9 cut(s) 140, 298, 402, 643, 709, 795, 841, 1045, 1390
AsiGI ACCGGT 1 cut(s) 1675
AspLEI GCGC 2 cut(s) 516, 921
AspS9I GGNCC 4 cut(s) 1132, 1234, 1318, 1628
AsuHPI GGTGA 6 cut(s) 55, 257, 575, 1270, 1399, 1448
AvaII GGWCC 2 cut(s) 1132, 1318
BaeI ACNNNNGTAYC 2 cut(s) 1007, 1040
BalI TGGCCA 2 cut(s) 477, 1086
BbsI GAAGAC 2 cut(s) 249, 1722
BccI CCATC 1 cut(s) 213
BciT130I CCWGG 2 cut(s) 111, 155
BcoDI GTCTC 1 cut(s) 592
BfaI CTAG 3 cut(s) 420, 1007, 1745
BfmI CTRYAG 1 cut(s) 1648
BglI GCCNNNNNGGC 1 cut(s) 745
BglII AGATCT 1 cut(s) 249
BlpI GCTNAGC 1 cut(s) 200
BmcAI AGTACT 1 cut(s) 74
Bme1390I CCNGG 2 cut(s) 111, 155
Bme18I GGWCC 2 cut(s) 1132, 1318
BmgT120I GGNCC 4 cut(s) 1132, 1234, 1318, 1628
BmiI GGNNCC 1 cut(s) 1823
BmrFI CCNGG 2 cut(s) 111, 155
BmsI GCATC 2 cut(s) 35, 727
BpiI GAAGAC 2 cut(s) 249, 1722
BpmI CTGGAG 2 cut(s) 743, 1362
Bpu1102I GCTNAGC 1 cut(s) 200
BsaJI CCNNGG 5 cut(s) 262, 333, 875, 1166, 1799
BsaWI WCCGGW 2 cut(s) 1567, 1675
BsaXI ACNNNNNCTCC 2 cut(s) 885, 915
Bsc4I CCNNNNNNNGG 3 cut(s) 64, 1129, 1433
Bse118I RCCGGY 2 cut(s) 40, 1675
Bse1I ACTGG 2 cut(s) 677, 1602
Bse3DI GCAATG 1 cut(s) 1197
BseAI TCCGGA 1 cut(s) 1567
BseBI CCWGG 2 cut(s) 111, 155
BseDI CCNNGG 5 cut(s) 262, 333, 875, 1166, 1799
BseGI GGATG 2 cut(s) 275, 1216
BseLI CCNNNNNNNGG 3 cut(s) 64, 1129, 1433
BseMI GCAATG 1 cut(s) 1197
BseMII CTCAG 3 cut(s) 1167, 1537, 1724
BseNI ACTGG 2 cut(s) 677, 1602
Bsh1236I CGCG 1 cut(s) 516
BshFI GGCC 4 cut(s) 477, 1086, 1236, 1629
BshTI ACCGGT 1 cut(s) 1675
BsiSI CCGG 3 cut(s) 41, 1568, 1676
BslFI GGGAC 3 cut(s) 199, 1678, 1755
BslI CCNNNNNNNGG 3 cut(s) 64, 1129, 1433
BsmAI GTCTC 1 cut(s) 592
BsmFI GGGAC 3 cut(s) 199, 1678, 1755
BsmI GAATGC 2 cut(s) 1167, 1252
BsnI GGCC 4 cut(s) 477, 1086, 1236, 1629
Bsp13I TCCGGA 1 cut(s) 1567
Bsp1407I TGTACA 3 cut(s) 192, 965, 1176
Bsp143I GATC 5 cut(s) 249, 523, 811, 1594, 1684
Bsp1720I GCTNAGC 1 cut(s) 200
Bsp19I CCATGG 1 cut(s) 1799
BspACI CCGC 1 cut(s) 1052
BspANI GGCC 4 cut(s) 477, 1086, 1236, 1629
BspCNI CTCAG 3 cut(s) 1166, 1536, 1725
BspEI TCCGGA 1 cut(s) 1567
BspFNI CGCG 1 cut(s) 516
BspLI GGNNCC 1 cut(s) 1823
BspMAI CTGCAG 1 cut(s) 1652
BspPI GGATC 1 cut(s) 1602
BsrDI GCAATG 1 cut(s) 1197
BsrFI RCCGGY 2 cut(s) 40, 1675
BsrGI TGTACA 3 cut(s) 192, 965, 1176
BsrI ACTGG 2 cut(s) 677, 1602
BssAI RCCGGY 2 cut(s) 40, 1675
BssECI CCNNGG 5 cut(s) 262, 333, 875, 1166, 1799
BssMI GATC 5 cut(s) 249, 523, 811, 1594, 1684
BssT1I CCWWGG 5 cut(s) 262, 333, 875, 1166, 1799
Bst2UI CCWGG 2 cut(s) 111, 155
Bst4CI ACNGT 3 cut(s) 765, 1669, 1721
Bst6I CTCTTC 1 cut(s) 902
BstAUI TGTACA 3 cut(s) 192, 965, 1176
BstC8I GCNNGC 1 cut(s) 782
BstDEI CTNAG 9 cut(s) 17, 200, 776, 989, 1058, 1153, 1298, 1523, 1733
BstDSI CCRYGG 1 cut(s) 1799
BstF5I GGATG 2 cut(s) 275, 1216
BstFNI CGCG 1 cut(s) 516
BstHHI GCGC 2 cut(s) 516, 921
BstKTI GATC 5 cut(s) 252, 526, 814, 1597, 1687
BstMAI GTCTC 1 cut(s) 592
BstMBI GATC 5 cut(s) 249, 523, 811, 1594, 1684
BstMWI GCNNNNNNNGC 2 cut(s) 724, 745
BstNI CCWGG 2 cut(s) 111, 155
BstNSI RCATGY 1 cut(s) 784
BstSCI CCNGG 2 cut(s) 109, 153
BstSFI CTRYAG 1 cut(s) 1648
BstUI CGCG 1 cut(s) 516
BstV2I GAAGAC 2 cut(s) 249, 1722
BstX2I RGATCY 1 cut(s) 249
BstYI RGATCY 1 cut(s) 249
BsuRI GGCC 4 cut(s) 477, 1086, 1236, 1629
BtgI CCRYGG 1 cut(s) 1799
BtsCI GGATG 2 cut(s) 275, 1216
BtsIMutI CAGTG 2 cut(s) 670, 1531
Cac8I GCNNGC 1 cut(s) 782
CfoI GCGC 2 cut(s) 516, 921
Cfr10I RCCGGY 2 cut(s) 40, 1675
Cfr13I GGNCC 4 cut(s) 1132, 1234, 1318, 1628
CseI GACGC 1 cut(s) 505
CsiI ACCWGGT 1 cut(s) 109
Csp6I GTAC 6 cut(s) 73, 193, 966, 1096, 1177, 1670
CspAI ACCGGT 1 cut(s) 1675
CviAII CATG 8 cut(s) 127, 242, 742, 781, 935, 1082, 1471, 1800
CviQI GTAC 6 cut(s) 73, 193, 966, 1096, 1177, 1670
DdeI CTNAG 9 cut(s) 17, 200, 776, 989, 1058, 1153, 1298, 1523, 1733
DpnI GATC 5 cut(s) 251, 525, 813, 1596, 1686
DpnII GATC 5 cut(s) 249, 523, 811, 1594, 1684
DraI TTTAAA 1 cut(s) 708
EaeI YGGCCR 2 cut(s) 475, 1084
Eam1104I CTCTTC 1 cut(s) 902
EarI CTCTTC 1 cut(s) 902
Eco130I CCWWGG 5 cut(s) 262, 333, 875, 1166, 1799
Eco47I GGWCC 2 cut(s) 1132, 1318
Eco57I CTGAAG 4 cut(s) 194, 734, 1374, 1568
EcoRII CCWGG 2 cut(s) 109, 153
EcoT14I CCWWGG 5 cut(s) 262, 333, 875, 1166, 1799
ErhI CCWWGG 5 cut(s) 262, 333, 875, 1166, 1799
FaeI CATG 8 cut(s) 130, 245, 745, 784, 938, 1085, 1474, 1803
FaqI GGGAC 3 cut(s) 199, 1678, 1755
FatI CATG 8 cut(s) 126, 241, 741, 780, 934, 1081, 1470, 1799
FokI GGATG 2 cut(s) 262, 1203
FspBI CTAG 3 cut(s) 420, 1007, 1745
FspI TGCGCA 1 cut(s) 920
GlaI GCGC 2 cut(s) 515, 920
GsuI CTGGAG 2 cut(s) 743, 1362
HaeIII GGCC 4 cut(s) 477, 1086, 1236, 1629
HapII CCGG 3 cut(s) 41, 1568, 1676
HgaI GACGC 1 cut(s) 505
HhaI GCGC 2 cut(s) 516, 921
Hin1II CATG 8 cut(s) 130, 245, 745, 784, 938, 1085, 1474, 1803
Hin6I GCGC 2 cut(s) 514, 919
HinP1I GCGC 2 cut(s) 514, 919
HincII GTYRAC 1 cut(s) 354
HindII GTYRAC 1 cut(s) 354
HindIII AAGCTT 3 cut(s) 491, 1076, 1844
HinfI GANTC 8 cut(s) 443, 451, 754, 772, 1419, 1454, 1474, 1564
HpaII CCGG 3 cut(s) 41, 1568, 1676
HphI GGTGA 6 cut(s) 55, 257, 575, 1270, 1399, 1448
Hpy166II GTNNAC 3 cut(s) 95, 354, 1645
Hpy188III TCNNGA 8 cut(s) 290, 362, 722, 983, 1155, 1341, 1460, 1568
Hpy8I GTNNAC 3 cut(s) 95, 354, 1645
HpyAV CCTTC 3 cut(s) 308, 1073, 1440
HpyCH4III ACNGT 3 cut(s) 765, 1669, 1721
HpyCH4IV ACGT 1 cut(s) 1254
HpyCH4V TGCA 9 cut(s) 11, 625, 913, 934, 1107, 1115, 1250, 1381, 1650
HpyF10VI GCNNNNNNNGC 2 cut(s) 724, 745
HpyF3I CTNAG 9 cut(s) 17, 200, 776, 989, 1058, 1153, 1298, 1523, 1733
HpySE526I ACGT 1 cut(s) 1254
Hsp92II CATG 8 cut(s) 130, 245, 745, 784, 938, 1085, 1474, 1803
HspAI GCGC 2 cut(s) 514, 919
Kpn2I TCCGGA 1 cut(s) 1567
Kzo9I GATC 5 cut(s) 249, 523, 811, 1594, 1684
LmnI GCTCC 3 cut(s) 724, 1501, 1803
LweI GCATC 2 cut(s) 35, 727
MabI ACCWGGT 1 cut(s) 109
MaeI CTAG 3 cut(s) 420, 1007, 1745
MaeII ACGT 1 cut(s) 1254
MaeIII GTNAC 3 cut(s) 43, 992, 1258
MalI GATC 5 cut(s) 251, 525, 813, 1596, 1686
MboI GATC 5 cut(s) 249, 523, 811, 1594, 1684
MflI RGATCY 1 cut(s) 249
MlsI TGGCCA 2 cut(s) 477, 1086
MluNI TGGCCA 2 cut(s) 477, 1086
MlyI GAGTC 3 cut(s) 452, 460, 763
MmeI TCCRAC 1 cut(s) 747
Mox20I TGGCCA 2 cut(s) 477, 1086
MroI TCCGGA 1 cut(s) 1567
MscI TGGCCA 2 cut(s) 477, 1086
MseI TTAA 8 cut(s) 138, 147, 296, 482, 575, 707, 860, 1212
MslI CAYNNNNRTG 1 cut(s) 933
Msp20I TGGCCA 2 cut(s) 477, 1086
MspI CCGG 3 cut(s) 41, 1568, 1676
MspR9I CCNGG 2 cut(s) 111, 155
Mva1269I GAATGC 2 cut(s) 1167, 1252
MvaI CCWGG 2 cut(s) 111, 155
MvnI CGCG 1 cut(s) 516
MwoI GCNNNNNNNGC 2 cut(s) 724, 745
NcoI CCATGG 1 cut(s) 1799
NdeII GATC 5 cut(s) 249, 523, 811, 1594, 1684
NlaIII CATG 8 cut(s) 130, 245, 745, 784, 938, 1085, 1474, 1803
NlaIV GGNNCC 1 cut(s) 1823
NmuCI GTSAC 2 cut(s) 43, 1258
NsbI TGCGCA 1 cut(s) 920
NspI RCATGY 1 cut(s) 784
PaeI GCATGC 1 cut(s) 784
PctI GAATGC 2 cut(s) 1167, 1252
PfeI GAWTC 5 cut(s) 772, 1419, 1454, 1474, 1564
PflMI CCANNNNNTGG 1 cut(s) 1129
PfoI TCCNGGA 1 cut(s) 153
PinAI ACCGGT 1 cut(s) 1675
PleI GAGTC 3 cut(s) 451, 459, 762
PpsI GAGTC 3 cut(s) 451, 459, 762
PsiI TTATAA 1 cut(s) 1401
Psp6I CCWGG 2 cut(s) 109, 153
PspGI CCWGG 2 cut(s) 109, 153
PspN4I GGNNCC 1 cut(s) 1823
PspPI GGNCC 4 cut(s) 1132, 1234, 1318, 1628
PsrI GAACNNNNNNTAC 2 cut(s) 1526, 1558
PstI CTGCAG 1 cut(s) 1652
PsuI RGATCY 1 cut(s) 249
RsaI GTAC 6 cut(s) 74, 194, 967, 1097, 1178, 1671
RsaNI GTAC 6 cut(s) 73, 193, 966, 1096, 1177, 1670
RseI CAYNNNNRTG 1 cut(s) 933
SaqAI TTAA 8 cut(s) 138, 147, 296, 482, 575, 707, 860, 1212
Sau3AI GATC 5 cut(s) 249, 523, 811, 1594, 1684
Sau96I GGNCC 4 cut(s) 1132, 1234, 1318, 1628
ScaI AGTACT 1 cut(s) 74
SchI GAGTC 3 cut(s) 452, 460, 763
ScrFI CCNGG 2 cut(s) 111, 155
SexAI ACCWGGT 1 cut(s) 109
SfaNI GCATC 2 cut(s) 35, 727
SfcI CTRYAG 1 cut(s) 1648
SinI GGWCC 2 cut(s) 1132, 1318
SmiMI CAYNNNNRTG 1 cut(s) 933
SphI GCATGC 1 cut(s) 784
SsiI CCGC 1 cut(s) 1052
SspI AATATT 2 cut(s) 808, 871
SspMI CTAG 3 cut(s) 420, 1007, 1745
StyD4I CCNGG 2 cut(s) 109, 153
StyI CCWWGG 5 cut(s) 262, 333, 875, 1166, 1799
TaaI ACNGT 3 cut(s) 765, 1669, 1721
TaiI ACGT 1 cut(s) 1257
TaqI TCGA 1 cut(s) 371
TatI WGTACW 4 cut(s) 72, 192, 965, 1176
TfiI GAWTC 5 cut(s) 772, 1419, 1454, 1474, 1564
Tru1I TTAA 8 cut(s) 138, 147, 296, 482, 575, 707, 860, 1212
Tru9I TTAA 8 cut(s) 138, 147, 296, 482, 575, 707, 860, 1212
TscAI CASTG 2 cut(s) 677, 1531
TseFI GTSAC 2 cut(s) 43, 1258
Tsp45I GTSAC 2 cut(s) 43, 1258
TspDTI ATGAA 4 cut(s) 230, 636, 1070, 1487
TspGWI ACGGA 2 cut(s) 1083, 1710
TspRI CASTG 2 cut(s) 677, 1531
Van91I CCANNNNNTGG 1 cut(s) 1129
VpaK11BI GGWCC 2 cut(s) 1132, 1318
XapI RAATTY 9 cut(s) 140, 298, 402, 643, 709, 795, 841, 1045, 1390
XceI RCATGY 1 cut(s) 784
XspI CTAG 3 cut(s) 420, 1007, 1745
ZrmI AGTACT 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.