pycom14g10700

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Forward (+)
13418769 .. 13419155
387 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 387 bp
ATGGAATCAAATCTCCACCTAAATGGGTTGTTGGAGAACCTGCAATCCTTGAAAATTGTTGTAATTCAAATCCAAGTAGTTAAGATGCTTCAAATGGAGCAGAAAAGGATTTATCTTACCACCCACCCAAGTATTACTGTTGTAGAAATCTCAATCAGAGAGGTGGAAATCTTGCTGAAAATTGGGATTAATGAGGCGAAGTTGAAGGATCTTGATATGTCAAACAACAATTTAAATGAATATATATCCGATATCTTTGAGAGTTTGTCTGGTTGTAGTTCGGAGAGAATAAAATCATTGTCATTGGGGTTTAATAATCTTTTAGGCCATTTTACAGATGATCACGTTAGAAAGTTTAGAAATTTAAACCACCTTTATCTTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

129

Amino Acids

14.72

Weight (kDa)

6.19

Isoelectric Point (pI)

32.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000281)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g21840 FvH4_5g27300 FvH4_7g26560 FvH4_7g26561 FvH4_7g26564 FvH4_7g26565 FvH4_7g26565 FvH4_7g26566 FvH4_7g26567 FvH4_7g26600 FvH4_7g26610
malus_domestica MD01G1000900.v1.1 MD01G1131400.v1.1 MD01G1165400.v1.1 MD01G1165600.v1.1 MD01G1172100.v1.1 MD01G1172300.v1.1 MD01G1172800.v1.1 MD01G1173000.v1.1 MD01G1174800.v1.1 MD01G1178700.v1.1 MD01G1178900.v1.1 MD01G1179300.v1.1 MD01G1179700.v1.1 MD01G1179800.v1.1 MD01G1180500.v1.1 MD04G1020400.v1.1 MD06G1026600.v1.1 MD08G1144300.v1.1 MD08G1144400.v1.1 MD08G1237900.v1.1 MD08G1238300.v1.1 MD08G1238900.v1.1 MD08G1239000.v1.1 MD08G1239100.v1.1 MD08G1239200.v1.1 MD11G1217100.v1.1 MD15G1414600.v1.1 MD15G1414700.v1.1 MD15G1414900.v1.1 MD15G1415000.v1.1 MD15G1426700.v1.1 MD15G1427000.v1.1 MD15G1429700.v1.1 MD15G1429800.v1.1 MD15G1430200.v1.1 MD15G1430300.v1.1 MD15G1439600.v1.1
prunus_persica Prupe.1G055200_v2.0.a1 Prupe.1G526400_v2.0.a1 Prupe.1G541000_v2.0.a1 Prupe.1G575100_v2.0.a1 Prupe.1G575200_v2.0.a1 Prupe.1G575300_v2.0.a1 Prupe.1G575500_v2.0.a1 Prupe.2G270000_v2.0.a1 Prupe.2G270200_v2.0.a1 Prupe.3G019500_v2.0.a1 Prupe.3G019600_v2.0.a1 Prupe.3G021800_v2.0.a1 Prupe.3G029200_v2.0.a1 Prupe.3G055300_v2.0.a1 Prupe.3G064900_v2.0.a1 Prupe.6G311600_v2.0.a1
pyrus_communis pycom01g18380 pycom01g18440 pycom01g18460 pycom01g18480 pycom01g18930 pycom01g18940 pycom01g18960 pycom01g18990 pycom01g19030 pycom01g19050 pycom01g19070 pycom08g20740 pycom08g20750 pycom11g19100 pycom12g20310 pycom14g10700 pycom15g10840 pycom15g37770 pycom15g37830 pycom15g37860 pycom15g38010 pycom15g38040 pycom15g38750 pycom420g00350 pycom420g00400 pycom420g00410 pycom420g00510 pycom420g00540 pycom976g00210
rosa_chinensis RchiOBHm_Chr1g0373231 RchiOBHm_Chr1g0373241 RchiOBHm_Chr1g0373251
rosa_laevigata RLG00000026834 RLG00000026835 RLG00000026836 RLG00000026837 RLG00000026839 RLG00000026840 RLG00000026841
rosa_multiflora Rmu_co8123616.1_g000001 Rmu_sc0000170.1_g000006 Rmu_sc0000170.1_g000007 Rmu_sc0000170.1_g000009 Rmu_sc0008079.1_g000015 Rmu_sc0013594.1_g000002
rosa_roxburghii Rroxscaffold_4G00284310 Rroxscaffold_4G00284320 Rroxscaffold_4G00284350 Rroxscaffold_4G00284370
rosa_rugosa Rorug01G0376700 Rorug01G0376800
rosa_samantha Rh1BG349500 Rh1CG362800 Rh3BG125200
rosa_wichuraiana Rw0G003040 Rw0G015420 Rw1G034010 Rw1G034020 Rw1G034030 Rw1G034950 Rw1G034960 Rw1G034970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 48
AclWI GGATC 1 cut(s) 216
AcsI RAATTY 1 cut(s) 361
AgsI TTSAA 4 cut(s) 52, 68, 92, 205
AloI GAACNNNNNNTCC 2 cut(s) 29, 61
AlwI GGATC 1 cut(s) 216
AoxI GGCC 1 cut(s) 325
ApoI RAATTY 1 cut(s) 361
AseI ATTAAT 1 cut(s) 189
BclI TGATCA 1 cut(s) 340
BfuAI ACCTGC 1 cut(s) 48
BmsI GCATC 1 cut(s) 75
BshFI GGCC 1 cut(s) 327
BsnI GGCC 1 cut(s) 327
Bsp143I GATC 2 cut(s) 208, 340
BspANI GGCC 1 cut(s) 327
BspMI ACCTGC 1 cut(s) 48
BspPI GGATC 1 cut(s) 216
BssMI GATC 2 cut(s) 208, 340
Bst4CI ACNGT 1 cut(s) 139
BstKTI GATC 2 cut(s) 211, 343
BstMBI GATC 2 cut(s) 208, 340
BstX2I RGATCY 1 cut(s) 208
BstXI CCANNNNNNTGG 1 cut(s) 23
BstYI RGATCY 1 cut(s) 208
BsuRI GGCC 1 cut(s) 327
BveI ACCTGC 1 cut(s) 48
CviJI RGCY 1 cut(s) 327
CviKI_1 RGCY 1 cut(s) 327
DpnI GATC 2 cut(s) 210, 342
DpnII GATC 2 cut(s) 208, 340
DraI TTTAAA 2 cut(s) 234, 366
Eco32I GATATC 1 cut(s) 253
EcoRV GATATC 1 cut(s) 253
FaiI YATR 3 cut(s) 218, 243, 245
FbaI TGATCA 1 cut(s) 340
HaeIII GGCC 1 cut(s) 327
HinfI GANTC 1 cut(s) 5
Hpy188I TCNGA 3 cut(s) 158, 250, 283
Hpy188III TCNNGA 2 cut(s) 212, 384
HpyAV CCTTC 1 cut(s) 199
HpyCH4III ACNGT 1 cut(s) 139
HpyCH4IV ACGT 1 cut(s) 345
HpyCH4V TGCA 1 cut(s) 43
HpySE526I ACGT 1 cut(s) 345
Ksp22I TGATCA 1 cut(s) 340
Kzo9I GATC 2 cut(s) 208, 340
LmnI GCTCC 1 cut(s) 97
LpnPI CCDG 2 cut(s) 53, 255
LweI GCATC 1 cut(s) 75
MaeII ACGT 1 cut(s) 345
MalI GATC 2 cut(s) 210, 342
MboI GATC 2 cut(s) 208, 340
MflI RGATCY 1 cut(s) 208
MluCI AATT 5 cut(s) 54, 63, 180, 229, 361
MmeI TCCRAC 1 cut(s) 12
MnlI CCTC 2 cut(s) 154, 187
MseI TTAA 5 cut(s) 81, 189, 233, 312, 365
MslI CAYNNNNRTG 1 cut(s) 21
NdeII GATC 2 cut(s) 208, 340
PfeI GAWTC 1 cut(s) 5
PshBI ATTAAT 1 cut(s) 189
PsuI RGATCY 1 cut(s) 208
RseI CAYNNNNRTG 1 cut(s) 21
SaqAI TTAA 5 cut(s) 81, 189, 233, 312, 365
Sau3AI GATC 2 cut(s) 208, 340
SetI ASST 5 cut(s) 21, 42, 165, 348, 375
SfaNI GCATC 1 cut(s) 75
SgeI CNNG 8 cut(s) 52, 61, 86, 141, 184, 224, 282, 356
SmiI ATTTAAAT 1 cut(s) 234
SmiMI CAYNNNNRTG 1 cut(s) 21
Sse9I AATT 5 cut(s) 54, 63, 180, 229, 361
SwaI ATTTAAAT 1 cut(s) 234
TaaI ACNGT 1 cut(s) 139
TaiI ACGT 1 cut(s) 348
TasI AATT 5 cut(s) 54, 63, 180, 229, 361
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 5 cut(s) 81, 189, 233, 312, 365
Tru9I TTAA 5 cut(s) 81, 189, 233, 312, 365
TspDTI ATGAA 1 cut(s) 252
VspI ATTAAT 1 cut(s) 189
XapI RAATTY 1 cut(s) 361
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.