Rmu_ssc0000064.1_g000017

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000064.1
OG0000274
Physical Location & Seq
Reverse (-)
94616 .. 95867
1252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000064.1_g000017.1.cds

Sequence Viewer

Length: 759 bp
atggacgctgtagaaaatgcacaaatcaataaagagccagaagagaaacagctacctcctgaggtcgtagactgggaggagagcaaagtatacaattttatggaccaggacaccaagaggagagtccagaaatactgtaaaaatgcaccatcaggacgaaaattctattttaaacttattgtcactggccaagttactgtccatgtaactgacaaagtaactggccaggccatcgttcatgtatatggcgaagtcactggccaagtcactgtccatgtaactgacaaagtaactggccagaccatcgttcatgtatatggcgaagtcactggccaagtcactgtccatgtaactgacaaagtaactggccagaccatcgttcatgtatatggcgaagtcactggccaagtcactgtccatgtaactgacaaagtaactggccagaccatcgttcatgtatatggagcacaggtttcaagacaggatttaaaagacataatcatggatgaaccgatagcaagcaattgcatcgaatgttatggaattctcttgactgatcagctgttggagaaagaatcacaaggcttggatgtcccaacttttatgaatcccttatgttgggttgaaatggtagagctttggatgacagcagtcaaagaacaagcagatgacatgctaggacaaggttgcaggatgcaatttgatgaaaaaaaacagttcagaagaacaactgaaaatgatggaagttccattgactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

252

Amino Acids

28.37

Weight (kDa)

5.04

Isoelectric Point (pI)

20.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000274)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g06730 FvH4_3g06731 FvH4_3g17150 FvH4_3g24490 FvH4_3g24741 FvH4_3g25201 FvH4_3g29860 FvH4_3g33300 FvH4_3g33780 FvH4_4g04830 FvH4_4g04901 FvH4_4g04910 FvH4_4g09190 FvH4_4g09870 FvH4_4g09880 FvH4_4g10501 FvH4_4g10502 FvH4_4g16800 FvH4_4g16810 FvH4_5g33260 FvH4_6g06051 FvH4_6g06060 FvH4_6g06060 FvH4_6g22011 FvH4_6g34230 FvH4_6g34231 FvH4_6g36690 FvH4_6g36710 FvH4_6g36720 FvH4_6g36740 FvH4_6g36750 FvH4_6g39110 FvH4_7g04250 FvH4_7g04250 FvH4_7g04380 FvH4_7g04390 FvH4_7g09690 FvH4_7g32810 FvH4_7g32820
pyrus_communis pycom02g10120
rosa_chinensis RchiOBHm_Chr0c39g0503121 RchiOBHm_Chr1g0327221 RchiOBHm_Chr1g0358931 RchiOBHm_Chr1g0358941 RchiOBHm_Chr3g0467921 RchiOBHm_Chr4g0402241 RchiOBHm_Chr6g0280581 RchiOBHm_Chr6g0298971 RchiOBHm_Chr7g0226761 RchiOBHm_Chr7g0226841 RchiOBHm_Chr7g0238631 RchiOBHm_Chr7g0243901
rosa_laevigata RLG00000015279 RLG00000029539
rosa_multiflora Rmu_co8451743.1_g000001 Rmu_sc0000270.1_g000001 Rmu_sc0000532.1_g000016 Rmu_sc0000885.1_g000002 Rmu_sc0001913.1_g000026 Rmu_sc0002080.1_g000032 Rmu_sc0002202.1_g000003 Rmu_sc0002202.1_g000006 Rmu_sc0005023.1_g000028 Rmu_sc0006388.1_g000017 Rmu_sc0011497.1_g000007 Rmu_sc0019088.1_g000001 Rmu_ssc0000064.1_g000017 Rmu_ssc0000170.1_g000013
rosa_roxburghii Rroxscaffold_1G00003820 Rroxscaffold_1G00015970 Rroxscaffold_1G00020360 Rroxscaffold_1G00064040 Rroxscaffold_1G00064120 Rroxscaffold_2G00086010 Rroxscaffold_2G00086020 Rroxscaffold_2G00095500 Rroxscaffold_2G00095510 Rroxscaffold_2G00102440 Rroxscaffold_2G00102970 Rroxscaffold_3G00231570 Rroxscaffold_3G00231830 Rroxscaffold_3G00250710 Rroxscaffold_3G00259420 Rroxscaffold_4G00277040 Rroxscaffold_4G00289320 Rroxscaffold_4G00289330 Rroxscaffold_4G00300150 Rroxscaffold_4G00328410 Rroxscaffold_5G00339120 Rroxscaffold_5G00349810 Rroxscaffold_5G00353990 Rroxscaffold_5G00366720 Rroxscaffold_5G00371400 Rroxscaffold_6G00411690 Rroxscaffold_6G00422190 Rroxscaffold_7G00157730 Rroxscaffold_7G00194130 Rroxscaffold_7G00196760 Rroxscaffold_7G00196770 Rroxscaffold_7G00208770
rosa_rugosa Rorug01G0230300 Rorug01G0261600 Rorug01G0360700 Rorug01G0489500 Rorug02G0176000 Rorug02G0337500 Rorug02G0570100 Rorug03G0270700 Rorug04G0114700 Rorug04G0130400 Rorug05G0073400 Rorug05G0565300 Rorug05G0565300
rosa_samantha Rh2BG158000 Rh2DG158000 Rh3AG113900 Rh3BG116900 Rh3CG119800 Rh3DG118800 Rh4BG396700 Rh5BG187400 Rh5BG211200 Rh7AG238800 Rh7AG300700 Rh7BG277000 Rh7CG068900 Rh7CG319200 Rh7CG472000 Rh7DG244600 Rh7DG475400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 69, 90
AcoI YGGCCR 8 cut(s) 187, 223, 259, 295, 331, 367, 403, 439
AcsI RAATTY 2 cut(s) 161, 543
AfiI CCNNNNNNNGG 1 cut(s) 618
AgsI TTSAA 2 cut(s) 477, 626
AjnI CCWGG 2 cut(s) 105, 225
AluBI AGCT 3 cut(s) 52, 562, 637
AluI AGCT 3 cut(s) 52, 562, 637
Alw21I GWGCWC 1 cut(s) 469
AoxI GGCC 9 cut(s) 187, 223, 228, 259, 295, 331, 367, 403, 439
ApoI RAATTY 2 cut(s) 161, 543
AspS9I GGNCC 1 cut(s) 103
AvaII GGWCC 1 cut(s) 103
AxyI CCTNAGG 1 cut(s) 60
BalI TGGCCA 8 cut(s) 189, 225, 261, 297, 333, 369, 405, 441
Bbv12I GWGCWC 1 cut(s) 469
BccI CCATC 6 cut(s) 157, 239, 311, 383, 455, 734
BcgI CGANNNNNNTGC 2 cut(s) 511, 545
BciT130I CCWGG 2 cut(s) 107, 227
BclI TGATCA 1 cut(s) 556
BfaI CTAG 1 cut(s) 677
BfmI CTRYAG 1 cut(s) 9
Bme1390I CCNGG 2 cut(s) 107, 227
Bme18I GGWCC 1 cut(s) 103
BmgT120I GGNCC 1 cut(s) 103
BmrFI CCNGG 2 cut(s) 107, 227
BmrI ACTGGG 1 cut(s) 82
BmsI GCATC 2 cut(s) 537, 684
BmuI ACTGGG 1 cut(s) 82
BoxI GACNNNNGTC 1 cut(s) 650
BsaXI ACNNNNNCTCC 2 cut(s) 456, 486
Bsc4I CCNNNNNNNGG 1 cut(s) 618
Bse1I ACTGG 9 cut(s) 77, 190, 226, 262, 298, 334, 370, 406, 442
Bse21I CCTNAGG 1 cut(s) 60
BseBI CCWGG 2 cut(s) 107, 227
BseGI GGATG 4 cut(s) 511, 595, 648, 699
BseLI CCNNNNNNNGG 1 cut(s) 618
BseMII CTCAG 1 cut(s) 51
BseNI ACTGG 9 cut(s) 77, 190, 226, 262, 298, 334, 370, 406, 442
BseRI GAGGAG 2 cut(s) 92, 133
BshFI GGCC 9 cut(s) 189, 225, 230, 261, 297, 333, 369, 405, 441
BsiHKAI GWGCWC 1 cut(s) 469
BslFI GGGAC 1 cut(s) 578
BslI CCNNNNNNNGG 1 cut(s) 618
BsmFI GGGAC 1 cut(s) 578
BsnI GGCC 9 cut(s) 189, 225, 230, 261, 297, 333, 369, 405, 441
Bsp1286I GDGCHC 1 cut(s) 469
Bsp143I GATC 1 cut(s) 556
BspANI GGCC 9 cut(s) 189, 225, 230, 261, 297, 333, 369, 405, 441
BspCNI CTCAG 1 cut(s) 52
BsrI ACTGG 9 cut(s) 77, 190, 226, 262, 298, 334, 370, 406, 442
BssMI GATC 1 cut(s) 556
BssNAI GTATAC 1 cut(s) 91
Bst1107I GTATAC 1 cut(s) 91
Bst2UI CCWGG 2 cut(s) 107, 227
Bst4CI ACNGT 6 cut(s) 137, 199, 271, 343, 415, 717
Bst6I CTCTTC 1 cut(s) 36
BstC8I GCNNGC 1 cut(s) 520
BstDEI CTNAG 1 cut(s) 60
BstF5I GGATG 4 cut(s) 511, 595, 648, 699
BstKTI GATC 1 cut(s) 559
BstMBI GATC 1 cut(s) 556
BstNI CCWGG 2 cut(s) 107, 227
BstNSI RCATGY 1 cut(s) 676
BstPAI GACNNNNGTC 1 cut(s) 650
BstSCI CCNGG 2 cut(s) 105, 225
BstSFI CTRYAG 1 cut(s) 9
BstZ17I GTATAC 1 cut(s) 91
Bsu36I CCTNAGG 1 cut(s) 60
BsuRI GGCC 9 cut(s) 189, 225, 230, 261, 297, 333, 369, 405, 441
BtsCI GGATG 4 cut(s) 511, 595, 648, 699
BtsIMutI CAGTG 7 cut(s) 183, 255, 267, 327, 339, 399, 411
Cac8I GCNNGC 1 cut(s) 520
Cfr13I GGNCC 1 cut(s) 103
CseI GACGC 1 cut(s) 14
DdeI CTNAG 1 cut(s) 60
DpnI GATC 1 cut(s) 558
DpnII GATC 1 cut(s) 556
DraI TTTAAA 2 cut(s) 172, 489
EaeI YGGCCR 8 cut(s) 187, 223, 259, 295, 331, 367, 403, 439
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
Eco47I GGWCC 1 cut(s) 103
Eco81I CCTNAGG 1 cut(s) 60
EcoRI GAATTC 1 cut(s) 543
EcoRII CCWGG 2 cut(s) 105, 225
FaqI GGGAC 1 cut(s) 578
FbaI TGATCA 1 cut(s) 556
FblI GTMKAC 2 cut(s) 69, 90
FokI GGATG 4 cut(s) 518, 602, 655, 706
FspBI CTAG 1 cut(s) 677
HaeIII GGCC 9 cut(s) 189, 225, 230, 261, 297, 333, 369, 405, 441
HgaI GACGC 1 cut(s) 14
HinfI GANTC 3 cut(s) 123, 575, 607
Hpy166II GTNNAC 2 cut(s) 70, 91
Hpy188I TCNGA 1 cut(s) 722
Hpy188III TCNNGA 5 cut(s) 59, 127, 153, 477, 550
Hpy8I GTNNAC 2 cut(s) 70, 91
HpyCH4III ACNGT 6 cut(s) 137, 199, 271, 343, 415, 717
HpyCH4V TGCA 5 cut(s) 20, 146, 528, 690, 697
HpyF3I CTNAG 1 cut(s) 60
Ksp22I TGATCA 1 cut(s) 556
Kzo9I GATC 1 cut(s) 556
LmnI GCTCC 1 cut(s) 464
LweI GCATC 2 cut(s) 537, 684
MaeI CTAG 1 cut(s) 677
MalI GATC 1 cut(s) 558
MboI GATC 1 cut(s) 556
MboII GAAGA 2 cut(s) 53, 735
MfeI CAATTG 1 cut(s) 523
MhlI GDGCHC 1 cut(s) 469
MlsI TGGCCA 8 cut(s) 189, 225, 261, 297, 333, 369, 405, 441
MluCI AATT 5 cut(s) 94, 161, 523, 543, 698
MluNI TGGCCA 8 cut(s) 189, 225, 261, 297, 333, 369, 405, 441
MlyI GAGTC 1 cut(s) 132
MmeI TCCRAC 1 cut(s) 546
MnlI CCTC 4 cut(s) 55, 66, 70, 111
Mox20I TGGCCA 8 cut(s) 189, 225, 261, 297, 333, 369, 405, 441
MscI TGGCCA 8 cut(s) 189, 225, 261, 297, 333, 369, 405, 441
MseI TTAA 2 cut(s) 171, 488
MslI CAYNNNNRTG 5 cut(s) 243, 315, 387, 459, 500
Msp20I TGGCCA 8 cut(s) 189, 225, 261, 297, 333, 369, 405, 441
MspA1I CMGCKG 1 cut(s) 562
MspR9I CCNGG 2 cut(s) 107, 227
MunI CAATTG 1 cut(s) 523
MvaI CCWGG 2 cut(s) 107, 227
NdeII GATC 1 cut(s) 556
NmuCI GTSAC 7 cut(s) 181, 253, 265, 325, 337, 397, 409
NspI RCATGY 1 cut(s) 676
PfeI GAWTC 2 cut(s) 575, 607
PleI GAGTC 1 cut(s) 131
PpsI GAGTC 1 cut(s) 131
PshAI GACNNNNGTC 1 cut(s) 650
Psp6I CCWGG 2 cut(s) 105, 225
PspGI CCWGG 2 cut(s) 105, 225
PspPI GGNCC 1 cut(s) 103
PvuII CAGCTG 1 cut(s) 562
RseI CAYNNNNRTG 5 cut(s) 243, 315, 387, 459, 500
SaqAI TTAA 2 cut(s) 171, 488
Sau3AI GATC 1 cut(s) 556
Sau96I GGNCC 1 cut(s) 103
SchI GAGTC 1 cut(s) 132
ScrFI CCNGG 2 cut(s) 107, 227
SduI GDGCHC 1 cut(s) 469
SetI ASST 7 cut(s) 54, 58, 66, 474, 564, 639, 688
SfaNI GCATC 2 cut(s) 537, 684
SfcI CTRYAG 1 cut(s) 9
SinI GGWCC 1 cut(s) 103
SmiMI CAYNNNNRTG 5 cut(s) 243, 315, 387, 459, 500
Sse9I AATT 5 cut(s) 94, 161, 523, 543, 698
SspMI CTAG 1 cut(s) 677
StyD4I CCNGG 2 cut(s) 105, 225
TaaI ACNGT 6 cut(s) 137, 199, 271, 343, 415, 717
TaqI TCGA 1 cut(s) 531
TasI AATT 5 cut(s) 94, 161, 523, 543, 698
TfiI GAWTC 2 cut(s) 575, 607
Tru1I TTAA 2 cut(s) 171, 488
Tru9I TTAA 2 cut(s) 171, 488
TscAI CASTG 7 cut(s) 190, 262, 274, 334, 346, 406, 418
TseFI GTSAC 7 cut(s) 181, 253, 265, 325, 337, 397, 409
Tsp45I GTSAC 7 cut(s) 181, 253, 265, 325, 337, 397, 409
TspDTI ATGAA 7 cut(s) 227, 299, 371, 443, 522, 620, 720
TspRI CASTG 7 cut(s) 190, 262, 274, 334, 346, 406, 418
VpaK11BI GGWCC 1 cut(s) 103
XapI RAATTY 2 cut(s) 161, 543
XceI RCATGY 1 cut(s) 676
XmiI GTMKAC 2 cut(s) 69, 90
XspI CTAG 1 cut(s) 677
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.