Rh7DG475400

Protein of unknown function (DUF707)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0000274
Physical Location & Seq
Reverse (-)
67911087 .. 67912454
1368 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG475400.1

Sequence Viewer

Length: 177 bp
ATGCTCGAAGCACATATGCGTTTCTTAGTGATAGCTTTCTTGATGCCTAGGTGGTTCGCAAAGCGTTTCTTACATCCTGATATAGTTGATCAATATAGTCGCATTCTTCTACAGGATGAGGACCTTGGAGTTGACAATTTCAATCCTCAACGGTACTATAGCTGCATTTCCTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF707

Protein Analysis

58

Amino Acids

7.07

Weight (kDa)

6.0

Isoelectric Point (pI)

44.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF707 PF05212 18 - 56 2.4e-15 Protein of unknown function (DUF707)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000274)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g06730 FvH4_3g06731 FvH4_3g17150 FvH4_3g24490 FvH4_3g24741 FvH4_3g25201 FvH4_3g29860 FvH4_3g33300 FvH4_3g33780 FvH4_4g04830 FvH4_4g04901 FvH4_4g04910 FvH4_4g09190 FvH4_4g09870 FvH4_4g09880 FvH4_4g10501 FvH4_4g10502 FvH4_4g16800 FvH4_4g16810 FvH4_5g33260 FvH4_6g06051 FvH4_6g06060 FvH4_6g06060 FvH4_6g22011 FvH4_6g34230 FvH4_6g34231 FvH4_6g36690 FvH4_6g36710 FvH4_6g36720 FvH4_6g36740 FvH4_6g36750 FvH4_6g39110 FvH4_7g04250 FvH4_7g04250 FvH4_7g04380 FvH4_7g04390 FvH4_7g09690 FvH4_7g32810 FvH4_7g32820
pyrus_communis pycom02g10120
rosa_chinensis RchiOBHm_Chr0c39g0503121 RchiOBHm_Chr1g0327221 RchiOBHm_Chr1g0358931 RchiOBHm_Chr1g0358941 RchiOBHm_Chr3g0467921 RchiOBHm_Chr4g0402241 RchiOBHm_Chr6g0280581 RchiOBHm_Chr6g0298971 RchiOBHm_Chr7g0226761 RchiOBHm_Chr7g0226841 RchiOBHm_Chr7g0238631 RchiOBHm_Chr7g0243901
rosa_laevigata RLG00000015279 RLG00000029539
rosa_multiflora Rmu_co8451743.1_g000001 Rmu_sc0000270.1_g000001 Rmu_sc0000532.1_g000016 Rmu_sc0000885.1_g000002 Rmu_sc0001913.1_g000026 Rmu_sc0002080.1_g000032 Rmu_sc0002202.1_g000003 Rmu_sc0002202.1_g000006 Rmu_sc0005023.1_g000028 Rmu_sc0006388.1_g000017 Rmu_sc0011497.1_g000007 Rmu_sc0019088.1_g000001 Rmu_ssc0000064.1_g000017 Rmu_ssc0000170.1_g000013
rosa_roxburghii Rroxscaffold_1G00003820 Rroxscaffold_1G00015970 Rroxscaffold_1G00020360 Rroxscaffold_1G00064040 Rroxscaffold_1G00064120 Rroxscaffold_2G00086010 Rroxscaffold_2G00086020 Rroxscaffold_2G00095500 Rroxscaffold_2G00095510 Rroxscaffold_2G00102440 Rroxscaffold_2G00102970 Rroxscaffold_3G00231570 Rroxscaffold_3G00231830 Rroxscaffold_3G00250710 Rroxscaffold_3G00259420 Rroxscaffold_4G00277040 Rroxscaffold_4G00289320 Rroxscaffold_4G00289330 Rroxscaffold_4G00300150 Rroxscaffold_4G00328410 Rroxscaffold_5G00339120 Rroxscaffold_5G00349810 Rroxscaffold_5G00353990 Rroxscaffold_5G00366720 Rroxscaffold_5G00371400 Rroxscaffold_6G00411690 Rroxscaffold_6G00422190 Rroxscaffold_7G00157730 Rroxscaffold_7G00194130 Rroxscaffold_7G00196760 Rroxscaffold_7G00196770 Rroxscaffold_7G00208770
rosa_rugosa Rorug01G0230300 Rorug01G0261600 Rorug01G0360700 Rorug01G0489500 Rorug02G0176000 Rorug02G0337500 Rorug02G0570100 Rorug03G0270700 Rorug04G0114700 Rorug04G0130400 Rorug05G0073400 Rorug05G0565300 Rorug05G0565300
rosa_samantha Rh2BG158000 Rh2DG158000 Rh3AG113900 Rh3BG116900 Rh3CG119800 Rh3DG118800 Rh4BG396700 Rh5BG187400 Rh5BG211200 Rh7AG238800 Rh7AG300700 Rh7BG277000 Rh7CG068900 Rh7CG319200 Rh7CG472000 Rh7DG244600 Rh7DG475400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 155
AgsI TTSAA 1 cut(s) 142
AluBI AGCT 2 cut(s) 35, 162
AluI AGCT 2 cut(s) 35, 162
ApeKI GCWGC 1 cut(s) 162
AspA2I CCTAGG 1 cut(s) 47
AspS9I GGNCC 1 cut(s) 121
AvaII GGWCC 1 cut(s) 121
AvrII CCTAGG 1 cut(s) 47
BbvI GCAGC 1 cut(s) 149
BclI TGATCA 1 cut(s) 88
BfaI CTAG 1 cut(s) 48
BfmI CTRYAG 2 cut(s) 110, 157
BisI GCNGC 1 cut(s) 163
BlnI CCTAGG 1 cut(s) 47
BlsI GCNGC 1 cut(s) 164
Bme18I GGWCC 1 cut(s) 121
BmgT120I GGNCC 1 cut(s) 121
BmsI GCATC 1 cut(s) 33
BsaJI CCNNGG 2 cut(s) 47, 124
BseDI CCNNGG 2 cut(s) 47, 124
BseGI GGATG 2 cut(s) 73, 121
BseXI GCAGC 1 cut(s) 149
BsmI GAATGC 1 cut(s) 102
Bsp143I GATC 1 cut(s) 88
BssECI CCNNGG 2 cut(s) 47, 124
BssMI GATC 1 cut(s) 88
BssT1I CCWWGG 2 cut(s) 47, 124
Bst4CI ACNGT 1 cut(s) 153
BstDEI CTNAG 1 cut(s) 25
BstF5I GGATG 2 cut(s) 73, 121
BstKTI GATC 1 cut(s) 91
BstMBI GATC 1 cut(s) 88
BstSFI CTRYAG 2 cut(s) 110, 157
BstV1I GCAGC 1 cut(s) 149
BtsCI GGATG 2 cut(s) 73, 121
Cfr13I GGNCC 1 cut(s) 121
Csp6I GTAC 1 cut(s) 154
CviJI RGCY 2 cut(s) 35, 162
CviKI_1 RGCY 2 cut(s) 35, 162
CviQI GTAC 1 cut(s) 154
DdeI CTNAG 1 cut(s) 25
DpnI GATC 1 cut(s) 90
DpnII GATC 1 cut(s) 88
Eco130I CCWWGG 2 cut(s) 47, 124
Eco47I GGWCC 1 cut(s) 121
EcoO109I RGGNCCY 1 cut(s) 121
EcoT14I CCWWGG 2 cut(s) 47, 124
ErhI CCWWGG 2 cut(s) 47, 124
FaiI YATR 5 cut(s) 15, 17, 83, 96, 159
FalI AAGNNNNNCTT 2 cut(s) 53, 85
FauNDI CATATG 1 cut(s) 15
FbaI TGATCA 1 cut(s) 88
Fnu4HI GCNGC 1 cut(s) 163
FokI GGATG 2 cut(s) 60, 128
Fsp4HI GCNGC 1 cut(s) 163
FspBI CTAG 1 cut(s) 48
GluI GCNGC 1 cut(s) 163
HincII GTYRAC 1 cut(s) 133
HindII GTYRAC 1 cut(s) 133
Hpy166II GTNNAC 1 cut(s) 133
Hpy188III TCNNGA 2 cut(s) 40, 77
Hpy8I GTNNAC 1 cut(s) 133
HpyCH4III ACNGT 1 cut(s) 153
HpyCH4V TGCA 1 cut(s) 165
HpyF3I CTNAG 1 cut(s) 25
Ksp22I TGATCA 1 cut(s) 88
Kzo9I GATC 1 cut(s) 88
LpnPI CCDG 2 cut(s) 90, 98
Lsp1109I GCAGC 1 cut(s) 149
LweI GCATC 1 cut(s) 33
MaeI CTAG 1 cut(s) 48
MalI GATC 1 cut(s) 90
MboI GATC 1 cut(s) 88
MboII GAAGA 1 cut(s) 98
MluCI AATT 1 cut(s) 136
MnlI CCTC 2 cut(s) 112, 156
Mva1269I GAATGC 1 cut(s) 102
NdeI CATATG 1 cut(s) 15
NdeII GATC 1 cut(s) 88
PctI GAATGC 1 cut(s) 102
PkrI GCNGC 1 cut(s) 164
PpuMI RGGWCCY 1 cut(s) 121
Psp5II RGGWCCY 1 cut(s) 121
PspPI GGNCC 1 cut(s) 121
PspPPI RGGWCCY 1 cut(s) 121
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
SatI GCNGC 1 cut(s) 163
Sau3AI GATC 1 cut(s) 88
Sau96I GGNCC 1 cut(s) 121
SetI ASST 4 cut(s) 37, 53, 126, 164
SfaNI GCATC 1 cut(s) 33
SfcI CTRYAG 2 cut(s) 110, 157
SgeI CNNG 6 cut(s) 17, 52, 60, 89, 125, 137
SinI GGWCC 1 cut(s) 121
Sse9I AATT 1 cut(s) 136
SspMI CTAG 1 cut(s) 48
StyI CCWWGG 2 cut(s) 47, 124
TaaI ACNGT 1 cut(s) 153
TaqI TCGA 1 cut(s) 6
TasI AATT 1 cut(s) 136
TseI GCWGC 1 cut(s) 162
VpaK11BI GGWCC 1 cut(s) 121
XmaJI CCTAGG 1 cut(s) 47
XspI CTAG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.