Rmu_ssc0000170.1_g000013

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000170.1
Physical Location & Seq
Forward (+)
56023 .. 56734
712 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000170.1_g000013.1.cds

Sequence Viewer

Length: 309 bp
atgatcatggatgaaccgagatcaagcaattgcatcgaatgttatggaattctcttgactgatcagctgttggagaaagaatcacaaggcttggatgtcccaacttttatgaatcccttatgctgggttgaaatggtagagctttggatgacagcagtcaaagaacaagcagatgacatgctaggacaaggttgcaggatgaaatttgatgaaaagaacagttcagaagaacaactgaaaatgatggaagttccattgacggaaacagagagagaaagaataaagtggatcaaggataactataaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

12.04

Weight (kDa)

4.46

Isoelectric Point (pI)

55.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000274)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g06730 FvH4_3g06731 FvH4_3g17150 FvH4_3g24490 FvH4_3g24741 FvH4_3g25201 FvH4_3g29860 FvH4_3g33300 FvH4_3g33780 FvH4_4g04830 FvH4_4g04901 FvH4_4g04910 FvH4_4g09190 FvH4_4g09870 FvH4_4g09880 FvH4_4g10501 FvH4_4g10502 FvH4_4g16800 FvH4_4g16810 FvH4_5g33260 FvH4_6g06051 FvH4_6g06060 FvH4_6g06060 FvH4_6g22011 FvH4_6g34230 FvH4_6g34231 FvH4_6g36690 FvH4_6g36710 FvH4_6g36720 FvH4_6g36740 FvH4_6g36750 FvH4_6g39110 FvH4_7g04250 FvH4_7g04250 FvH4_7g04380 FvH4_7g04390 FvH4_7g09690 FvH4_7g32810 FvH4_7g32820
pyrus_communis pycom02g10120
rosa_chinensis RchiOBHm_Chr0c39g0503121 RchiOBHm_Chr1g0327221 RchiOBHm_Chr1g0358931 RchiOBHm_Chr1g0358941 RchiOBHm_Chr3g0467921 RchiOBHm_Chr4g0402241 RchiOBHm_Chr6g0280581 RchiOBHm_Chr6g0298971 RchiOBHm_Chr7g0226761 RchiOBHm_Chr7g0226841 RchiOBHm_Chr7g0238631 RchiOBHm_Chr7g0243901
rosa_laevigata RLG00000015279 RLG00000029539
rosa_multiflora Rmu_co8451743.1_g000001 Rmu_sc0000270.1_g000001 Rmu_sc0000532.1_g000016 Rmu_sc0000885.1_g000002 Rmu_sc0001913.1_g000026 Rmu_sc0002080.1_g000032 Rmu_sc0002202.1_g000003 Rmu_sc0002202.1_g000006 Rmu_sc0005023.1_g000028 Rmu_sc0006388.1_g000017 Rmu_sc0011497.1_g000007 Rmu_sc0019088.1_g000001 Rmu_ssc0000064.1_g000017 Rmu_ssc0000170.1_g000013
rosa_roxburghii Rroxscaffold_1G00003820 Rroxscaffold_1G00015970 Rroxscaffold_1G00020360 Rroxscaffold_1G00064040 Rroxscaffold_1G00064120 Rroxscaffold_2G00086010 Rroxscaffold_2G00086020 Rroxscaffold_2G00095500 Rroxscaffold_2G00095510 Rroxscaffold_2G00102440 Rroxscaffold_2G00102970 Rroxscaffold_3G00231570 Rroxscaffold_3G00231830 Rroxscaffold_3G00250710 Rroxscaffold_3G00259420 Rroxscaffold_4G00277040 Rroxscaffold_4G00289320 Rroxscaffold_4G00289330 Rroxscaffold_4G00300150 Rroxscaffold_4G00328410 Rroxscaffold_5G00339120 Rroxscaffold_5G00349810 Rroxscaffold_5G00353990 Rroxscaffold_5G00366720 Rroxscaffold_5G00371400 Rroxscaffold_6G00411690 Rroxscaffold_6G00422190 Rroxscaffold_7G00157730 Rroxscaffold_7G00194130 Rroxscaffold_7G00196760 Rroxscaffold_7G00196770 Rroxscaffold_7G00208770
rosa_rugosa Rorug01G0230300 Rorug01G0261600 Rorug01G0360700 Rorug01G0489500 Rorug02G0176000 Rorug02G0337500 Rorug02G0570100 Rorug03G0270700 Rorug04G0114700 Rorug04G0130400 Rorug05G0073400 Rorug05G0565300 Rorug05G0565300
rosa_samantha Rh2BG158000 Rh2DG158000 Rh3AG113900 Rh3BG116900 Rh3CG119800 Rh3DG118800 Rh4BG396700 Rh5BG187400 Rh5BG211200 Rh7AG238800 Rh7AG300700 Rh7BG277000 Rh7CG068900 Rh7CG319200 Rh7CG472000 Rh7DG244600 Rh7DG475400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 296
AcsI RAATTY 2 cut(s) 48, 203
AfiI CCNNNNNNNGG 1 cut(s) 123
AgsI TTSAA 1 cut(s) 131
AluBI AGCT 2 cut(s) 67, 142
AluI AGCT 2 cut(s) 67, 142
AlwI GGATC 1 cut(s) 296
ApoI RAATTY 2 cut(s) 48, 203
BccI CCATC 1 cut(s) 238
BcgI CGANNNNNNTGC 2 cut(s) 16, 50
BclI TGATCA 2 cut(s) 3, 61
BfaI CTAG 1 cut(s) 182
BmsI GCATC 1 cut(s) 42
BoxI GACNNNNGTC 1 cut(s) 155
Bsc4I CCNNNNNNNGG 1 cut(s) 123
BseGI GGATG 4 cut(s) 16, 100, 153, 204
BseLI CCNNNNNNNGG 1 cut(s) 123
BseYI CCCAGC 1 cut(s) 123
BslFI GGGAC 1 cut(s) 83
BslI CCNNNNNNNGG 1 cut(s) 123
BsmFI GGGAC 1 cut(s) 83
Bsp143I GATC 4 cut(s) 3, 20, 61, 288
BspPI GGATC 1 cut(s) 296
BssMI GATC 4 cut(s) 3, 20, 61, 288
Bst4CI ACNGT 1 cut(s) 221
BstF5I GGATG 4 cut(s) 16, 100, 153, 204
BstKTI GATC 4 cut(s) 6, 23, 64, 291
BstMBI GATC 4 cut(s) 3, 20, 61, 288
BstNSI RCATGY 1 cut(s) 181
BstPAI GACNNNNGTC 1 cut(s) 155
BtsCI GGATG 4 cut(s) 16, 100, 153, 204
CviAII CATG 2 cut(s) 7, 178
CviJI RGCY 3 cut(s) 67, 90, 142
CviKI_1 RGCY 3 cut(s) 67, 90, 142
DpnI GATC 4 cut(s) 5, 22, 63, 290
DpnII GATC 4 cut(s) 3, 20, 61, 288
EcoRI GAATTC 1 cut(s) 48
FaeI CATG 2 cut(s) 10, 181
FaiI YATR 6 cut(s) 8, 45, 110, 121, 179, 303
FaqI GGGAC 1 cut(s) 83
FatI CATG 2 cut(s) 6, 177
FbaI TGATCA 2 cut(s) 3, 61
FokI GGATG 4 cut(s) 23, 107, 160, 211
FspBI CTAG 1 cut(s) 182
GsaI CCCAGC 1 cut(s) 127
Hin1II CATG 2 cut(s) 10, 181
HinfI GANTC 2 cut(s) 80, 112
Hpy188I TCNGA 1 cut(s) 226
Hpy188III TCNNGA 1 cut(s) 55
HpyCH4III ACNGT 1 cut(s) 221
HpyCH4V TGCA 2 cut(s) 33, 195
Hsp92II CATG 2 cut(s) 10, 181
Ksp22I TGATCA 2 cut(s) 3, 61
Kzo9I GATC 4 cut(s) 3, 20, 61, 288
LpnPI CCDG 2 cut(s) 109, 181
LweI GCATC 1 cut(s) 42
MaeI CTAG 1 cut(s) 182
MalI GATC 4 cut(s) 5, 22, 63, 290
MboI GATC 4 cut(s) 3, 20, 61, 288
MboII GAAGA 1 cut(s) 239
MfeI CAATTG 1 cut(s) 28
MluCI AATT 3 cut(s) 28, 48, 203
MmeI TCCRAC 1 cut(s) 51
MspA1I CMGCKG 1 cut(s) 67
MunI CAATTG 1 cut(s) 28
NdeII GATC 4 cut(s) 3, 20, 61, 288
NlaIII CATG 2 cut(s) 10, 181
NspI RCATGY 1 cut(s) 181
PfeI GAWTC 2 cut(s) 80, 112
PshAI GACNNNNGTC 1 cut(s) 155
PspFI CCCAGC 1 cut(s) 123
PvuII CAGCTG 1 cut(s) 67
Sau3AI GATC 4 cut(s) 3, 20, 61, 288
SetI ASST 3 cut(s) 69, 144, 193
SfaNI GCATC 1 cut(s) 42
Sse9I AATT 3 cut(s) 28, 48, 203
SspMI CTAG 1 cut(s) 182
TaaI ACNGT 1 cut(s) 221
TaqI TCGA 1 cut(s) 36
TasI AATT 3 cut(s) 28, 48, 203
TfiI GAWTC 2 cut(s) 80, 112
TspDTI ATGAA 4 cut(s) 27, 125, 215, 225
TspGWI ACGGA 1 cut(s) 275
XapI RAATTY 2 cut(s) 48, 203
XceI RCATGY 1 cut(s) 181
XspI CTAG 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.