RLG00000028881

F-box kelch-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Forward (+)
29676210 .. 29676671
462 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000028881

Sequence Viewer

Length: 462 bp
ATGAAAACTACTCATGATCGTTTGCTTATCCAAACTAGGGAACGTAGGATGGATAGAAAGTTCTTGTCACTCTTTTGTGCCGATACATTTGCCAAGTTTTCGGAGATAGAGCTTCCAATGATCAAAATTAAATCATATTTCCGCATTGTGGGTTCCCACAATGGAGTGGTTTGCTTATGTGATAGTGATTATGAAACATATCTACGGAATCCGTCAATCAGAAAATTCAAGAGACTTCCCCAGGCCCTCATTGATAGAAGAGGGCTATTATTAGCTCGCTCTGCTATCGGGTTCGGGTTCCATCCTGAAGGTGATGACTTTAAAATTGTGAGAACTTTGACATTTTTACGTCGTAATATAAATGAACTTGAGGTTTATAGCCATAGGTTGGAGGCTTGGAGAAGAATTAATGCAGTTCCCCCTACTTCACATGAACCGTATATTCAGGGAGAAGGAATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

154

Amino Acids

17.99

Weight (kDa)

9.71

Isoelectric Point (pI)

45.39

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FBA_3 PF08268 32 - 146 3.8e-06 F-box associated beta propeller domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000234)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18880 FvH4_2g02020 FvH4_2g02020 FvH4_2g37110 FvH4_6g33750 FvH4_6g33770 FvH4_6g34412 FvH4_7g08973
malus_domestica MD09G1191300.v1.1 MD09G1281000.v1.1 MD09G1281100.v1.1 MD09G1281200.v1.1 MD12G1050800.v1.1
prunus_persica Prupe.1G188300_v2.0.a1 Prupe.2G120700_v2.0.a1 Prupe.3G013300_v2.0.a1 Prupe.3G013500_v2.0.a1 Prupe.3G047100_v2.0.a1 Prupe.3G047200_v2.0.a1 Prupe.3G047300_v2.0.a1 Prupe.3G047400_v2.0.a1 Prupe.6G319100_v2.0.a1
pyrus_communis pycom09g18870 pycom11g17570 pycom12g04520 pycom14g04100
rosa_chinensis RchiOBHm_Chr1g0321721 RchiOBHm_Chr1g0321751 RchiOBHm_Chr1g0344471 RchiOBHm_Chr1g0344741 RchiOBHm_Chr1g0344891 RchiOBHm_Chr2g0143631 RchiOBHm_Chr2g0143641 RchiOBHm_Chr2g0144781 RchiOBHm_Chr3g0458821 RchiOBHm_Chr6g0245251 RchiOBHm_Chr6g0304681
rosa_laevigata RLG00000007681 RLG00000010222 RLG00000013320 RLG00000015313 RLG00000017431 RLG00000017439 RLG00000020055 RLG00000020056 RLG00000020112 RLG00000025133 RLG00000028872 RLG00000028881 RLG00000028884 RLG00000030407
rosa_multiflora Rmu_co8324891.1_g000001 Rmu_sc0000087.1_g000002 Rmu_sc0001288.1_g000009 Rmu_sc0001634.1_g000031 Rmu_sc0001942.1_g000032 Rmu_sc0003410.1_g000036 Rmu_sc0003909.1_g000002 Rmu_sc0004340.1_g000024 Rmu_sc0005308.1_g000008 Rmu_sc0005705.1_g000040 Rmu_sc0016560.1_g000002 Rmu_ssc0000167.1_g000005
rosa_roxburghii Rroxscaffold_2G00101580 Rroxscaffold_4G00309600 Rroxscaffold_4G00309710 Rroxscaffold_4G00327490 Rroxscaffold_5G00333360 Rroxscaffold_6G00420770 Rroxscaffold_7G00163600 Rroxscaffold_7G00215330
rosa_rugosa Rorug01G0174400 Rorug02G0213500 Rorug02G0384500 Rorug02G0384500 Rorug02G0384500 Rorug03G0032100 Rorug03G0301100 Rorug05G0513100
rosa_samantha Rh1AG045800 Rh1AG046600 Rh1AG191000 Rh1AG191200 Rh1AG192400 Rh1BG045100 Rh1BG157400 Rh1BG158200 Rh1CG048800 Rh1CG176300 Rh1CG177700 Rh1DG053100 Rh1DG055000 Rh1DG188800 Rh2AG180100 Rh2AG180200 Rh2AG436400 Rh2AG436500 Rh2AG441300 Rh2BG444000 Rh2BG444100 Rh2BG452000 Rh2CG422700 Rh2CG422800 Rh2CG428600 Rh2DG185900 Rh2DG186000 Rh2DG454300 Rh2DG454400 Rh2DG461700 Rh3AG089700 Rh3BG092600 Rh3CG092900 Rh3DG093600 Rh4AG005900 Rh4DG004900 Rh4DG010300 Rh4DG010400 Rh4DG230700 Rh6AG028300 Rh6AG445500 Rh6BG024500 Rh6BG456400 Rh6BG456500 Rh6CG022600 Rh6CG458300 Rh6CG458400 Rh6DG022600 Rh6DG445500
rosa_wichuraiana Rw1G004020 Rw1G004060 Rw1G004180 Rw1G015690 Rw1G015790 Rw2G014090 Rw2G035570 Rw2G035580 Rw2G036090 Rw3G007680 Rw6G002380 Rw6G038740

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 388
AciI CCGC 1 cut(s) 142
AcsI RAATTY 1 cut(s) 224
AcuI CTGAAG 1 cut(s) 327
AfiI CCNNNNNNNGG 3 cut(s) 37, 148, 388
AgsI TTSAA 1 cut(s) 229
AjnI CCWGG 1 cut(s) 240
AloI GAACNNNNNNTCC 2 cut(s) 44, 76
AluBI AGCT 2 cut(s) 112, 275
AluI AGCT 2 cut(s) 112, 275
Alw26I GTCTC 1 cut(s) 226
AoxI GGCC 1 cut(s) 243
ApoI RAATTY 1 cut(s) 224
AseI ATTAAT 1 cut(s) 408
AspS9I GGNCC 1 cut(s) 244
AsuHPI GGTGA 1 cut(s) 323
BccI CCATC 2 cut(s) 43, 309
BcgI CGANNNNNNTGC 2 cut(s) 71, 105
BciT130I CCWGG 1 cut(s) 242
BclI TGATCA 1 cut(s) 120
BcoDI GTCTC 1 cut(s) 226
BfaI CTAG 1 cut(s) 36
Bme1390I CCNGG 1 cut(s) 242
BmgT120I GGNCC 1 cut(s) 244
BmiI GGNNCC 2 cut(s) 154, 299
BmrFI CCNGG 1 cut(s) 242
BpuEI CTTGAG 1 cut(s) 389
BsaJI CCNNGG 1 cut(s) 240
Bsc4I CCNNNNNNNGG 3 cut(s) 37, 148, 388
BseBI CCWGG 1 cut(s) 242
BseDI CCNNGG 1 cut(s) 240
BseGI GGATG 2 cut(s) 54, 301
BseLI CCNNNNNNNGG 3 cut(s) 37, 148, 388
BshFI GGCC 1 cut(s) 245
BslI CCNNNNNNNGG 3 cut(s) 37, 148, 388
BsmAI GTCTC 1 cut(s) 226
BsnI GGCC 1 cut(s) 245
Bsp143I GATC 2 cut(s) 16, 120
BspACI CCGC 1 cut(s) 142
BspANI GGCC 1 cut(s) 245
BspHI TCATGA 1 cut(s) 13
BspLI GGNNCC 2 cut(s) 154, 299
BssECI CCNNGG 1 cut(s) 240
BssMI GATC 2 cut(s) 16, 120
Bst2UI CCWGG 1 cut(s) 242
Bst4CI ACNGT 1 cut(s) 438
Bst6I CTCTTC 1 cut(s) 253
BstC8I GCNNGC 1 cut(s) 277
BstF5I GGATG 2 cut(s) 54, 301
BstKTI GATC 2 cut(s) 19, 123
BstMAI GTCTC 1 cut(s) 226
BstMBI GATC 2 cut(s) 16, 120
BstMWI GCNNNNNNNGC 1 cut(s) 281
BstNI CCWGG 1 cut(s) 242
BstSCI CCNGG 1 cut(s) 240
BsuRI GGCC 1 cut(s) 245
BtsCI GGATG 2 cut(s) 54, 301
Cac8I GCNNGC 1 cut(s) 277
CciI TCATGA 1 cut(s) 13
Cfr13I GGNCC 1 cut(s) 244
CviAII CATG 2 cut(s) 14, 431
CviJI RGCY 6 cut(s) 112, 245, 265, 275, 381, 395
CviKI_1 RGCY 6 cut(s) 112, 245, 265, 275, 381, 395
DpnI GATC 2 cut(s) 18, 122
DpnII GATC 2 cut(s) 16, 120
DraI TTTAAA 1 cut(s) 322
Eam1104I CTCTTC 1 cut(s) 253
EarI CTCTTC 1 cut(s) 253
Eco57I CTGAAG 1 cut(s) 327
EcoO109I RGGNCCY 1 cut(s) 244
EcoRII CCWGG 1 cut(s) 240
FaeI CATG 2 cut(s) 17, 434
FatI CATG 2 cut(s) 13, 430
FbaI TGATCA 1 cut(s) 120
FokI GGATG 2 cut(s) 61, 288
FspBI CTAG 1 cut(s) 36
HaeIII GGCC 1 cut(s) 245
Hin1II CATG 2 cut(s) 17, 434
HinfI GANTC 1 cut(s) 208
HphI GGTGA 1 cut(s) 323
Hpy188I TCNGA 2 cut(s) 103, 221
Hpy188III TCNNGA 3 cut(s) 14, 229, 305
Hpy99I CGWCG 1 cut(s) 354
HpyAV CCTTC 2 cut(s) 302, 446
HpyCH4III ACNGT 1 cut(s) 438
HpyCH4IV ACGT 2 cut(s) 43, 349
HpyCH4V TGCA 1 cut(s) 413
HpyF10VI GCNNNNNNNGC 1 cut(s) 281
HpySE526I ACGT 2 cut(s) 43, 349
Hsp92II CATG 2 cut(s) 17, 434
Ksp22I TGATCA 1 cut(s) 120
Kzo9I GATC 2 cut(s) 16, 120
LpnPI CCDG 4 cut(s) 227, 254, 318, 431
MaeI CTAG 1 cut(s) 36
MaeII ACGT 2 cut(s) 43, 349
MaeIII GTNAC 1 cut(s) 66
MalI GATC 2 cut(s) 18, 122
MboI GATC 2 cut(s) 16, 120
MboII GAAGA 2 cut(s) 270, 414
MluCI AATT 4 cut(s) 126, 224, 324, 405
MmeI TCCRAC 1 cut(s) 369
MnlI CCTC 4 cut(s) 254, 257, 364, 385
MseI TTAA 3 cut(s) 129, 321, 408
MspR9I CCNGG 1 cut(s) 242
MvaI CCWGG 1 cut(s) 242
MwoI GCNNNNNNNGC 1 cut(s) 281
NdeII GATC 2 cut(s) 16, 120
NlaIII CATG 2 cut(s) 17, 434
NlaIV GGNNCC 2 cut(s) 154, 299
NmuCI GTSAC 1 cut(s) 66
PagI TCATGA 1 cut(s) 13
PfeI GAWTC 1 cut(s) 208
PflMI CCANNNNNTGG 1 cut(s) 388
PshBI ATTAAT 1 cut(s) 408
Psp6I CCWGG 1 cut(s) 240
PspGI CCWGG 1 cut(s) 240
PspN4I GGNNCC 2 cut(s) 154, 299
PspPI GGNCC 1 cut(s) 244
SaqAI TTAA 3 cut(s) 129, 321, 408
Sau3AI GATC 2 cut(s) 16, 120
Sau96I GGNCC 1 cut(s) 244
ScrFI CCNGG 1 cut(s) 242
SetI ASST 7 cut(s) 46, 114, 277, 313, 352, 375, 389
SmlI CTYRAG 1 cut(s) 368
SmoI CTYRAG 1 cut(s) 368
Sse9I AATT 4 cut(s) 126, 224, 324, 405
SsiI CCGC 1 cut(s) 142
SspMI CTAG 1 cut(s) 36
StyD4I CCNGG 1 cut(s) 240
TaaI ACNGT 1 cut(s) 438
TaiI ACGT 2 cut(s) 46, 352
TasI AATT 4 cut(s) 126, 224, 324, 405
TfiI GAWTC 1 cut(s) 208
Tru1I TTAA 3 cut(s) 129, 321, 408
Tru9I TTAA 3 cut(s) 129, 321, 408
TseFI GTSAC 1 cut(s) 66
Tsp45I GTSAC 1 cut(s) 66
TspDTI ATGAA 4 cut(s) 17, 207, 378, 447
TspGWI ACGGA 2 cut(s) 201, 220
Van91I CCANNNNNTGG 1 cut(s) 388
VspI ATTAAT 1 cut(s) 408
XapI RAATTY 1 cut(s) 224
XspI CTAG 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.