Rh4DG004900

F-box kelch-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0000234
Physical Location & Seq
Forward (+)
802598 .. 802849
252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG004900.1

Sequence Viewer

Length: 252 bp
ATGGAGGTTTATACTCTTAGCACAAATTCTTGGACGATTATTCAAGTCATGCCACCTTGGCTCAACACTACGAAGTTTTCTACTCGATATGAATTTTGGAATGGAATGGAATATTGGCTTGCTACGAGAGATTTAATGGTTAGGGTTGTGTTGTTTGATACTAATAATGAAGAATTTGAAGAAGTGGTGATCCTAATTACTATTTTGAATGATGATTGGGATGCATATATCAAAGTGATGATTGGGATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box

Protein Analysis

83

Amino Acids

9.99

Weight (kDa)

4.16

Isoelectric Point (pI)

17.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000234)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18880 FvH4_2g02020 FvH4_2g02020 FvH4_2g37110 FvH4_6g33750 FvH4_6g33770 FvH4_6g34412 FvH4_7g08973
malus_domestica MD09G1191300.v1.1 MD09G1281000.v1.1 MD09G1281100.v1.1 MD09G1281200.v1.1 MD12G1050800.v1.1
prunus_persica Prupe.1G188300_v2.0.a1 Prupe.2G120700_v2.0.a1 Prupe.3G013300_v2.0.a1 Prupe.3G013500_v2.0.a1 Prupe.3G047100_v2.0.a1 Prupe.3G047200_v2.0.a1 Prupe.3G047300_v2.0.a1 Prupe.3G047400_v2.0.a1 Prupe.6G319100_v2.0.a1
pyrus_communis pycom09g18870 pycom11g17570 pycom12g04520 pycom14g04100
rosa_chinensis RchiOBHm_Chr1g0321721 RchiOBHm_Chr1g0321751 RchiOBHm_Chr1g0344471 RchiOBHm_Chr1g0344741 RchiOBHm_Chr1g0344891 RchiOBHm_Chr2g0143631 RchiOBHm_Chr2g0143641 RchiOBHm_Chr2g0144781 RchiOBHm_Chr3g0458821 RchiOBHm_Chr6g0245251 RchiOBHm_Chr6g0304681
rosa_laevigata RLG00000007681 RLG00000010222 RLG00000013320 RLG00000015313 RLG00000017431 RLG00000017439 RLG00000020055 RLG00000020056 RLG00000020112 RLG00000025133 RLG00000028872 RLG00000028881 RLG00000028884 RLG00000030407
rosa_multiflora Rmu_co8324891.1_g000001 Rmu_sc0000087.1_g000002 Rmu_sc0001288.1_g000009 Rmu_sc0001634.1_g000031 Rmu_sc0001942.1_g000032 Rmu_sc0003410.1_g000036 Rmu_sc0003909.1_g000002 Rmu_sc0004340.1_g000024 Rmu_sc0005308.1_g000008 Rmu_sc0005705.1_g000040 Rmu_sc0016560.1_g000002 Rmu_ssc0000167.1_g000005
rosa_roxburghii Rroxscaffold_2G00101580 Rroxscaffold_4G00309600 Rroxscaffold_4G00309710 Rroxscaffold_4G00327490 Rroxscaffold_5G00333360 Rroxscaffold_6G00420770 Rroxscaffold_7G00163600 Rroxscaffold_7G00215330
rosa_rugosa Rorug01G0174400 Rorug02G0213500 Rorug02G0384500 Rorug02G0384500 Rorug02G0384500 Rorug03G0032100 Rorug03G0301100 Rorug05G0513100
rosa_samantha Rh1AG045800 Rh1AG046600 Rh1AG191000 Rh1AG191200 Rh1AG192400 Rh1BG045100 Rh1BG157400 Rh1BG158200 Rh1CG048800 Rh1CG176300 Rh1CG177700 Rh1DG053100 Rh1DG055000 Rh1DG188800 Rh2AG180100 Rh2AG180200 Rh2AG436400 Rh2AG436500 Rh2AG441300 Rh2BG444000 Rh2BG444100 Rh2BG452000 Rh2CG422700 Rh2CG422800 Rh2CG428600 Rh2DG185900 Rh2DG186000 Rh2DG454300 Rh2DG454400 Rh2DG461700 Rh3AG089700 Rh3BG092600 Rh3CG092900 Rh3DG093600 Rh4AG005900 Rh4DG004900 Rh4DG010300 Rh4DG010400 Rh4DG230700 Rh6AG028300 Rh6AG445500 Rh6BG024500 Rh6BG456400 Rh6BG456500 Rh6CG022600 Rh6CG458300 Rh6CG458400 Rh6DG022600 Rh6DG445500
rosa_wichuraiana Rw1G004020 Rw1G004060 Rw1G004180 Rw1G015690 Rw1G015790 Rw2G014090 Rw2G035570 Rw2G035580 Rw2G036090 Rw3G007680 Rw6G002380 Rw6G038740

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 184
AcsI RAATTY 3 cut(s) 25, 92, 173
AgsI TTSAA 3 cut(s) 44, 179, 208
AjuI GAANNNNNNNTTGG 2 cut(s) 97, 129
AlwI GGATC 1 cut(s) 184
ApoI RAATTY 3 cut(s) 25, 92, 173
AsuHPI GGTGA 1 cut(s) 199
BglI GCCNNNNNGGC 1 cut(s) 58
BmsI GCATC 1 cut(s) 211
BsaJI CCNNGG 1 cut(s) 56
BseDI CCNNGG 1 cut(s) 56
BseGI GGATG 2 cut(s) 226, 252
Bsp143I GATC 1 cut(s) 189
BspPI GGATC 1 cut(s) 184
BssECI CCNNGG 1 cut(s) 56
BssMI GATC 1 cut(s) 189
BssT1I CCWWGG 1 cut(s) 56
BstC8I GCNNGC 1 cut(s) 120
BstDEI CTNAG 1 cut(s) 17
BstF5I GGATG 2 cut(s) 226, 252
BstKTI GATC 1 cut(s) 192
BstMBI GATC 1 cut(s) 189
BstMWI GCNNNNNNNGC 1 cut(s) 58
BtsCI GGATG 2 cut(s) 226, 252
Cac8I GCNNGC 1 cut(s) 120
CviAII CATG 1 cut(s) 49
CviJI RGCY 2 cut(s) 61, 118
CviKI_1 RGCY 2 cut(s) 61, 118
DdeI CTNAG 1 cut(s) 17
DpnI GATC 1 cut(s) 191
DpnII GATC 1 cut(s) 189
Eco130I CCWWGG 1 cut(s) 56
EcoT14I CCWWGG 1 cut(s) 56
EcoT22I ATGCAT 1 cut(s) 226
ErhI CCWWGG 1 cut(s) 56
FaeI CATG 1 cut(s) 52
FaiI YATR 5 cut(s) 12, 50, 90, 226, 228
FatI CATG 1 cut(s) 48
FokI GGATG 1 cut(s) 233
Hin1II CATG 1 cut(s) 52
HphI GGTGA 1 cut(s) 199
HpyCH4V TGCA 1 cut(s) 224
HpyF10VI GCNNNNNNNGC 1 cut(s) 58
HpyF3I CTNAG 1 cut(s) 17
Hsp92II CATG 1 cut(s) 52
Kzo9I GATC 1 cut(s) 189
LweI GCATC 1 cut(s) 211
MalI GATC 1 cut(s) 191
MboI GATC 1 cut(s) 189
MboII GAAGA 2 cut(s) 182, 191
MluCI AATT 4 cut(s) 25, 92, 173, 195
Mph1103I ATGCAT 1 cut(s) 226
MseI TTAA 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 58
NdeII GATC 1 cut(s) 189
NlaIII CATG 1 cut(s) 52
NsiI ATGCAT 1 cut(s) 226
SaqAI TTAA 1 cut(s) 134
Sau3AI GATC 1 cut(s) 189
SetI ASST 2 cut(s) 9, 58
SfaNI GCATC 1 cut(s) 211
SgeI CNNG 7 cut(s) 42, 56, 61, 69, 96, 131, 138
Sse9I AATT 4 cut(s) 25, 92, 173, 195
SspI AATATT 1 cut(s) 113
StyI CCWWGG 1 cut(s) 56
TaqI TCGA 1 cut(s) 85
TasI AATT 4 cut(s) 25, 92, 173, 195
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TspDTI ATGAA 2 cut(s) 105, 183
XapI RAATTY 3 cut(s) 25, 92, 173
Zsp2I ATGCAT 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.