Rmu_co8495701.1_g000001

BEST Arabidopsis thaliana protein match is Arabidopsis protein of

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8495701.1
Physical Location & Seq
Forward (+)
1 .. 1569
1569 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8495701.1_g000001.1.cds

Sequence Viewer

Length: 754 bp
attgacgtctttcgaagccacctccacatcatcatcatcaataagtcaccaactaaattgtctgcaagacttgcatgattgtgttgatatattgcttcaattgccactcacccaacaagccttagcccaagagaagcatgaaaaatgggctaatgaactattagatggctctctcaggctcttggatatttgcagcactgccaaagatgccttgttgccaaccaaggaatgcattcagaaccttcagtcaatcgtccgaagaagaggaggaggagaatctgatgtactcgcaagtgaagttaggaaatacttaacctccaggaagatggtgaaagagtcactccacaaggctatggggaatttgaaggaaatggaaaacaaatccaatttctattccctcaacaaggaccaagagacaatcgccattattagcaagctgagagaagttgaagcagtcactcgaacagtgtttgaaccaatattgtccttcatctctgggccaaaggtatcaagcagctggtcatttatatccaagatgatgcagtcaaaaagagtagcttgtgaggaagaagcagaagtaaaccaatttgcagaggtggatgctgcattgaagtcacacaagagtttagacaatgcacaaaaccagcttaacaatctggagtcatgcatccaagaccaagaagaaggactcgagtgcctatttaggcaattgataaaaacaagagtctccctactcaacatcctcaaccactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

250

Amino Acids

28.14

Weight (kDa)

5.76

Isoelectric Point (pI)

57.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000199)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G17043 AT2G17070 AT2G17080 AT4G35200 AT4G35210
fragaria_vesca FvH4_2g16200 FvH4_2g16201 FvH4_2g16202 FvH4_2g16203 FvH4_2g16204 FvH4_2g16205 FvH4_2g16220 FvH4_2g16230 FvH4_2g16240 FvH4_2g16270 FvH4_2g16280 FvH4_2g16290 FvH4_2g16310 FvH4_2g16311 FvH4_2g16313
malus_domestica MD02G1121100.v1.1 MD05G1130600.v1.1 MD05G1130700.v1.1 MD05G1130800.v1.1 MD05G1131000.v1.1 MD05G1131200.v1.1 MD10G1133600.v1.1 MD10G1134000.v1.1 MD10G1134100.v1.1 MD10G1134300.v1.1 MD12G1141200.v1.1
prunus_persica Prupe.2G076800_v2.0.a1 Prupe.2G142500_v2.0.a1 Prupe.2G142900_v2.0.a1 Prupe.8G175000_v2.0.a1 Prupe.8G175200_v2.0.a1 Prupe.8G175300_v2.0.a1 Prupe.8G175400_v2.0.a1 Prupe.8G175600_v2.0.a1 Prupe.8G175700_v2.0.a1 Prupe.8G175800_v2.0.a1 Prupe.8G175900_v2.0.a1 Prupe.8G176000_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0358831 RchiOBHm_Chr6g0279881 RchiOBHm_Chr6g0279891 RchiOBHm_Chr6g0279901 RchiOBHm_Chr6g0279931 RchiOBHm_Chr6g0279941 RchiOBHm_Chr6g0280051 RchiOBHm_Chr6g0280061 RchiOBHm_Chr6g0280071
rosa_laevigata RLG00000002309 RLG00000013093 RLG00000013094 RLG00000013099 RLG00000013104 RLG00000013106 RLG00000013107 RLG00000013109 RLG00000013110 RLG00000013111
rosa_multiflora Rmu_co8441615.1_g000001 Rmu_co8465321.1_g000001 Rmu_co8495701.1_g000001 Rmu_sc0002340.1_g000003 Rmu_sc0002504.1_g000006 Rmu_sc0002504.1_g000007 Rmu_sc0002504.1_g000017 Rmu_sc0002504.1_g000018 Rmu_sc0004617.1_g000019 Rmu_sc0008097.1_g000001 Rmu_sc0010352.1_g000001
rosa_roxburghii Rroxscaffold_6G00396480 Rroxscaffold_7G00188440 Rroxscaffold_7G00188450 Rroxscaffold_7G00188460 Rroxscaffold_7G00188470 Rroxscaffold_7G00188480 Rroxscaffold_7G00188490 Rroxscaffold_7G00188530 Rroxscaffold_7G00188540 Rroxscaffold_7G00188550
rosa_rugosa Rorug05G0490200.1 Rorug06G0128800 Rorug06G0128800 Rorug06G0128800 Rorug06G0128900 Rorug06G0128900 Rorug06G0129000 Rorug06G0129100 Rorug06G0129700 Rorug06G0129800 Rorug06G0129900
rosa_samantha Rh5AG427100 Rh6AG237500 Rh6AG237600 Rh6AG237700 Rh6AG237800 Rh6AG237900 Rh6AG238100 Rh6AG238200 Rh6AG238300 Rh6AG238700 Rh6AG238800 Rh6AG239100 Rh6AG239600 Rh6BG241600 Rh6BG241700 Rh6BG241800 Rh6BG241900 Rh6BG242100 Rh6BG242300 Rh6BG242400 Rh6BG243200 Rh6BG243500 Rh6BG243600 Rh6BG243700 Rh6CG243800 Rh6CG243900 Rh6CG244000 Rh6CG244100 Rh6CG244300 Rh6CG244400 Rh6CG245100 Rh6CG245300 Rh6CG245400 Rh6DG234600 Rh6DG234700 Rh6DG234800 Rh6DG234900 Rh6DG235000 Rh6DG235100 Rh6DG236000 Rh6DG236200 Rh6DG236300
rosa_wichuraiana Rw3G023160 Rw4G032750 Rw6G020650 Rw6G020660 Rw6G020680 Rw6G020690 Rw6G020710 Rw6G020750 Rw6G020760 Rw6G020770 Rw6G020780 Rw6G020790 Rw6G020800 Rw6G020810 Rw6G020860 Rw6G020900 Rw6G020910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 9
AcsI RAATTY 1 cut(s) 359
AcuI CTGAAG 1 cut(s) 228
AcyI GRCGYC 1 cut(s) 6
AfaI GTAC 1 cut(s) 286
AfiI CCNNNNNNNGG 1 cut(s) 404
AgsI TTSAA 5 cut(s) 99, 365, 450, 474, 611
AjnI CCWGG 1 cut(s) 318
AluBI AGCT 4 cut(s) 437, 517, 558, 647
AluI AGCT 4 cut(s) 437, 517, 558, 647
Alw26I GTCTC 2 cut(s) 408, 731
Ama87I CYCGRG 1 cut(s) 690
AoxI GGCC 1 cut(s) 498
ApeKI GCWGC 3 cut(s) 193, 514, 603
ApoI RAATTY 1 cut(s) 359
Asp700I GAANNNNTTC 1 cut(s) 232
AspS9I GGNCC 2 cut(s) 407, 498
AsuHPI GGTGA 3 cut(s) 39, 101, 341
AsuII TTCGAA 1 cut(s) 13
AvaI CYCGRG 1 cut(s) 690
AvaII GGWCC 1 cut(s) 407
BbvI GCAGC 3 cut(s) 205, 526, 590
BccI CCATC 2 cut(s) 159, 320
BciT130I CCWGG 1 cut(s) 320
BcoDI GTCTC 2 cut(s) 408, 731
BfaI CTAG 1 cut(s) 752
BisI GCNGC 3 cut(s) 194, 515, 604
BlsI GCNGC 3 cut(s) 195, 516, 605
Bme1390I CCNGG 1 cut(s) 320
Bme18I GGWCC 1 cut(s) 407
BmeT110I CYCGRG 1 cut(s) 690
BmgT120I GGNCC 2 cut(s) 407, 498
BmrFI CCNGG 1 cut(s) 320
BmsI GCATC 4 cut(s) 197, 529, 590, 676
BpmI CTGGAG 2 cut(s) 302, 678
Bpu10I CCTNAGC 1 cut(s) 122
Bpu14I TTCGAA 1 cut(s) 13
BsaHI GRCGYC 1 cut(s) 6
BsaJI CCNNGG 1 cut(s) 223
BsaXI ACNNNNNCTCC 2 cut(s) 300, 330
Bsc4I CCNNNNNNNGG 1 cut(s) 404
BseBI CCWGG 1 cut(s) 320
BseDI CCNNGG 1 cut(s) 223
BseGI GGATG 3 cut(s) 605, 667, 739
BseLI CCNNNNNNNGG 1 cut(s) 404
BseMII CTCAG 2 cut(s) 188, 429
BseRI GAGGAG 3 cut(s) 280, 283, 286
BseXI GCAGC 3 cut(s) 205, 526, 590
BshFI GGCC 1 cut(s) 500
BsiHKCI CYCGRG 1 cut(s) 690
BslI CCNNNNNNNGG 1 cut(s) 404
BsmAI GTCTC 2 cut(s) 408, 731
BsmI GAATGC 2 cut(s) 232, 234
BsnI GGCC 1 cut(s) 500
BsoBI CYCGRG 1 cut(s) 690
Bsp119I TTCGAA 1 cut(s) 13
BspANI GGCC 1 cut(s) 500
BspCNI CTCAG 2 cut(s) 187, 430
BspT104I TTCGAA 1 cut(s) 13
BssECI CCNNGG 1 cut(s) 223
BssNI GRCGYC 1 cut(s) 6
BssT1I CCWWGG 1 cut(s) 223
Bst2UI CCWGG 1 cut(s) 320
Bst4CI ACNGT 1 cut(s) 467
Bst6I CTCTTC 1 cut(s) 257
BstACI GRCGYC 1 cut(s) 6
BstAPI GCANNNNNTGC 1 cut(s) 71
BstBI TTCGAA 1 cut(s) 13
BstC8I GCNNGC 1 cut(s) 435
BstDEI CTNAG 3 cut(s) 122, 174, 438
BstENI CCTNNNNNAGG 1 cut(s) 402
BstF5I GGATG 3 cut(s) 605, 667, 739
BstMAI GTCTC 2 cut(s) 408, 731
BstMWI GCNNNNNNNGC 3 cut(s) 71, 101, 207
BstNI CCWGG 1 cut(s) 320
BstSCI CCNGG 1 cut(s) 318
BstV1I GCAGC 3 cut(s) 205, 526, 590
BstXI CCANNNNNNTGG 1 cut(s) 326
BsuRI GGCC 1 cut(s) 500
BtsCI GGATG 3 cut(s) 605, 667, 739
BtsI GCAGTG 1 cut(s) 196
BtsIMutI CAGTG 2 cut(s) 196, 472
Cac8I GCNNGC 1 cut(s) 435
Cfr13I GGNCC 2 cut(s) 407, 498
Csp6I GTAC 1 cut(s) 285
CviAII CATG 3 cut(s) 75, 138, 664
CviQI GTAC 1 cut(s) 285
DdeI CTNAG 3 cut(s) 122, 174, 438
Eam1104I CTCTTC 1 cut(s) 257
EarI CTCTTC 1 cut(s) 257
Eco130I CCWWGG 1 cut(s) 223
Eco47I GGWCC 1 cut(s) 407
Eco57I CTGAAG 1 cut(s) 228
Eco88I CYCGRG 1 cut(s) 690
EcoNI CCTNNNNNAGG 1 cut(s) 402
EcoRII CCWGG 1 cut(s) 318
EcoT14I CCWWGG 1 cut(s) 223
EcoT22I ATGCAT 2 cut(s) 234, 669
ErhI CCWWGG 1 cut(s) 223
FaeI CATG 3 cut(s) 78, 141, 667
FaiI YATR 6 cut(s) 76, 90, 139, 354, 528, 665
FalI AAGNNNNNCTT 2 cut(s) 542, 574
FatI CATG 3 cut(s) 74, 137, 663
Fnu4HI GCNGC 3 cut(s) 194, 515, 604
FokI GGATG 3 cut(s) 612, 654, 726
Fsp4HI GCNGC 3 cut(s) 194, 515, 604
FspBI CTAG 1 cut(s) 752
GluI GCNGC 3 cut(s) 194, 515, 604
GsuI CTGGAG 2 cut(s) 302, 678
HaeIII GGCC 1 cut(s) 500
Hin1I GRCGYC 1 cut(s) 6
Hin1II CATG 3 cut(s) 78, 141, 667
HinfI GANTC 5 cut(s) 276, 336, 660, 688, 724
HphI GGTGA 3 cut(s) 39, 101, 341
Hpy166II GTNNAC 1 cut(s) 581
Hpy188I TCNGA 3 cut(s) 238, 258, 281
Hpy188III TCNNGA 1 cut(s) 657
Hpy8I GTNNAC 1 cut(s) 581
HpyAV CCTTC 4 cut(s) 252, 359, 497, 678
HpyCH4III ACNGT 1 cut(s) 467
HpyCH4IV ACGT 1 cut(s) 6
HpyCH4V TGCA 9 cut(s) 65, 74, 193, 232, 542, 591, 606, 636, 667
HpyF10VI GCNNNNNNNGC 3 cut(s) 71, 101, 207
HpyF3I CTNAG 3 cut(s) 122, 174, 438
HpySE526I ACGT 1 cut(s) 6
Hsp92I GRCGYC 1 cut(s) 6
Hsp92II CATG 3 cut(s) 78, 141, 667
LpnPI CCDG 7 cut(s) 161, 305, 332, 481, 503, 642, 657
Lsp1109I GCAGC 3 cut(s) 205, 526, 590
LweI GCATC 4 cut(s) 197, 529, 590, 676
MaeI CTAG 1 cut(s) 752
MaeII ACGT 1 cut(s) 6
MaeIII GTNAC 4 cut(s) 45, 337, 455, 613
MboII GAAGA 5 cut(s) 271, 274, 335, 579, 693
MfeI CAATTG 2 cut(s) 99, 708
MluCI AATT 6 cut(s) 56, 99, 359, 386, 585, 708
MlyI GAGTC 4 cut(s) 345, 669, 682, 733
MnlI CCTC 9 cut(s) 32, 258, 261, 264, 326, 408, 557, 587, 753
Mph1103I ATGCAT 2 cut(s) 234, 669
MroXI GAANNNNTTC 1 cut(s) 232
MseI TTAA 2 cut(s) 312, 649
MslI CAYNNNNRTG 1 cut(s) 79
MspA1I CMGCKG 1 cut(s) 517
MspR9I CCNGG 1 cut(s) 320
MunI CAATTG 2 cut(s) 99, 708
Mva1269I GAATGC 2 cut(s) 232, 234
MvaI CCWGG 1 cut(s) 320
MwoI GCNNNNNNNGC 3 cut(s) 71, 101, 207
NlaIII CATG 3 cut(s) 78, 141, 667
NmuCI GTSAC 4 cut(s) 45, 337, 455, 613
NsiI ATGCAT 2 cut(s) 234, 669
NspV TTCGAA 1 cut(s) 13
PaeR7I CTCGAG 1 cut(s) 690
PctI GAATGC 2 cut(s) 232, 234
PdmI GAANNNNTTC 1 cut(s) 232
PfeI GAWTC 1 cut(s) 276
PfoI TCCNGGA 1 cut(s) 318
PkrI GCNGC 3 cut(s) 195, 516, 605
PleI GAGTC 4 cut(s) 344, 668, 682, 732
PpsI GAGTC 4 cut(s) 344, 668, 682, 732
Psp6I CCWGG 1 cut(s) 318
PspGI CCWGG 1 cut(s) 318
PspPI GGNCC 2 cut(s) 407, 498
PspXI VCTCGAGB 1 cut(s) 690
PvuII CAGCTG 1 cut(s) 517
RsaI GTAC 1 cut(s) 286
RsaNI GTAC 1 cut(s) 285
RseI CAYNNNNRTG 1 cut(s) 79
SaqAI TTAA 2 cut(s) 312, 649
SatI GCNGC 3 cut(s) 194, 515, 604
Sau96I GGNCC 2 cut(s) 407, 498
SchI GAGTC 4 cut(s) 345, 669, 682, 733
ScrFI CCNGG 1 cut(s) 320
SfaNI GCATC 4 cut(s) 197, 529, 590, 676
Sfr274I CTCGAG 1 cut(s) 690
SfuI TTCGAA 1 cut(s) 13
SinI GGWCC 1 cut(s) 407
SlaI CTCGAG 1 cut(s) 690
SmiMI CAYNNNNRTG 1 cut(s) 79
SmlI CTYRAG 1 cut(s) 690
SmoI CTYRAG 1 cut(s) 690
Sse9I AATT 6 cut(s) 56, 99, 359, 386, 585, 708
SspI AATATT 1 cut(s) 481
SspMI CTAG 1 cut(s) 752
StyD4I CCNGG 1 cut(s) 318
StyI CCWWGG 1 cut(s) 223
TaaI ACNGT 1 cut(s) 467
TaiI ACGT 1 cut(s) 9
TaqI TCGA 3 cut(s) 13, 461, 691
TasI AATT 6 cut(s) 56, 99, 359, 386, 585, 708
TatI WGTACW 1 cut(s) 284
TfiI GAWTC 1 cut(s) 276
Tru1I TTAA 2 cut(s) 312, 649
Tru9I TTAA 2 cut(s) 312, 649
TscAI CASTG 2 cut(s) 203, 472
TseFI GTSAC 4 cut(s) 45, 337, 455, 613
TseI GCWGC 3 cut(s) 193, 514, 603
Tsp45I GTSAC 4 cut(s) 45, 337, 455, 613
TspDTI ATGAA 3 cut(s) 154, 169, 479
TspRI CASTG 2 cut(s) 203, 472
VpaK11BI GGWCC 1 cut(s) 407
XagI CCTNNNNNAGG 1 cut(s) 402
XapI RAATTY 1 cut(s) 359
XhoI CTCGAG 1 cut(s) 690
XmnI GAANNNNTTC 1 cut(s) 232
XspI CTAG 1 cut(s) 752
ZraI GACGTC 1 cut(s) 7
Zsp2I ATGCAT 2 cut(s) 234, 669
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.